DNASU Plasmid Repository • 480.965.5697 | Email

CASP3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CASP3
Gene Name:  caspase 3, apoptosis-related cysteine peptidase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH013999.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00001930

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 834nts         Open reading frame : 1 to 834
Reference Sequence Alignment

ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1061
Start on reference sequence 228
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CASP3
Symbol Nomenclature : CASP3
SYNONYM : CPP32; CPP32B; SCA-1
Designation : CASP-3|CPP-32|PARP cleavage protease|SREBP cleavage activity 1|apopain|caspase 3, apoptosis-related cysteine protease|caspase-3|cysteine protease CPP32|procaspase3|protein Yama
Full Nomenclature : caspase 3, apoptosis-related cysteine peptidase
GENEID : 836
GI : 61369706
GenBank Accession : AY891451
HGNC : 1504
MIM : 600636
Vega : OTTHUMG00000133681
Target GenBank: BC016926

 

Reference Sequence Alignment

  

HsCD00001930      ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
NM_004346.3       ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
NM_032991.2       ATGGAGAACACTGAAAACTCAGTGGATTCAAAATCCATTAAAAATTTGGAACCAAAGATC
                  ************************************************************

HsCD00001930      ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
NM_004346.3       ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
NM_032991.2       ATACATGGAAGCGAATCAATGGACTCTGGAATATCCCTGGACAACAGTTATAAAATGGAT
                  ************************************************************

HsCD00001930      TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
NM_004346.3       TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
NM_032991.2       TATCCTGAGATGGGTTTATGTATAATAATTAATAATAAGAATTTTCATAAAAGCACTGGA
                  ************************************************************

HsCD00001930      ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
NM_004346.3       ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
NM_032991.2       ATGACATCTCGGTCTGGTACAGATGTCGATGCAGCAAACCTCAGGGAAACATTCAGAAAC
                  ************************************************************

HsCD00001930      TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
NM_004346.3       TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
NM_032991.2       TTGAAATATGAAGTCAGGAATAAAAATGATCTTACACGTGAAGAAATTGTGGAATTGATG
                  ************************************************************

HsCD00001930      CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
NM_004346.3       CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
NM_032991.2       CGTGATGTTTCTAAAGAAGATCACAGCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGC
                  ************************************************************

HsCD00001930      CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
NM_004346.3       CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
NM_032991.2       CATGGTGAAGAAGGAATAATTTTTGGAACAAATGGACCTGTTGACCTGAAAAAAATAACA
                  ************************************************************

HsCD00001930      AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
NM_004346.3       AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
NM_032991.2       AACTTTTTCAGAGGGGATCGTTGTAGAAGTCTAACTGGAAAACCCAAACTTTTCATTATT
                  ************************************************************

HsCD00001930      CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
NM_004346.3       CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
NM_032991.2       CAGGCCTGCCGTGGTACAGAACTGGACTGTGGCATTGAGACAGACAGTGGTGTTGATGAT
                  ************************************************************

HsCD00001930      GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
NM_004346.3       GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
NM_032991.2       GACATGGCGTGTCATAAAATACCAGTGGAGGCCGACTTCTTGTATGCATACTCCACAGCA
                  ************************************************************

HsCD00001930      CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
NM_004346.3       CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
NM_032991.2       CCTGGTTATTATTCTTGGCGAAATTCAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGT
                  ************************************************************

HsCD00001930      GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
NM_004346.3       GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
NM_032991.2       GCCATGCTGAAACAGTATGCCGACAAGCTTGAATTTATGCACATTCTTACCCGGGTTAAC
                  ************************************************************

HsCD00001930      CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
NM_004346.3       CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
NM_032991.2       CGAAAGGTGGCAACAGAATTTGAGTCCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAA
                  ************************************************************

HsCD00001930      CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTTG
NM_004346.3       CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAA
NM_032991.2       CAGATTCCATGTATTGTTTCCATGCTCACAAAAGAACTCTATTTTTATCACTAA
                  ****************************************************:.

Pathways

NCI : Calcineurin-regulated NFAT-dependent transcription in lymphocytes
NCI : Caspase Cascade in Apoptosis
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : LPA receptor mediated events
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Role of Calcineurin-dependent NFAT signaling in lymphocytes
NCI : Syndecan-2-mediated signaling events
NCI : p75(NTR)-mediated signaling
Panther : Apoptosis signaling pathway
Panther : FAS signaling pathway
Panther : Huntington disease
Reactome : Activation of DNA fragmentation factor
Reactome : Activation of caspases through apoptosome-mediated cleavage
Reactome : Apoptosis
Reactome : Apoptosis induced DNA fragmentation
Reactome : Apoptotic cleavage of cell adhesion proteins
Reactome : Apoptotic cleavage of cellular proteins
Reactome : Apoptotic execution phase
Reactome : Apoptotic factor-mediated response
Reactome : Caspase-mediated cleavage of cytoskeletal proteins
Reactome : Cell death signalling via NRAGE, NRIF and NADE
Reactome : Cytochrome c-mediated apoptotic response
Reactome : Degradation of the extracellular matrix
Reactome : Extracellular matrix organization
Reactome : Intrinsic Pathway for Apoptosis
Reactome : NADE modulates death signalling
Reactome : Regulation of Apoptosis
Reactome : Role of DCC in regulating apoptosis
Reactome : SMAC binds to IAPs
Reactome : SMAC-mediated apoptotic response
Reactome : SMAC-mediated dissociation of IAP:caspase complexes
Reactome : Signal Transduction
Reactome : Signaling by Hippo
Reactome : Signalling by NGF
Reactome : Stimulation of the cell death response by PAK-2p34
Reactome : p75 NTR receptor-mediated signalling
WikiPathway : Alzheimers Disease
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : DNA damage response
WikiPathway : FAS pathway and Stress induction of HSP regulation
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : miRNA regulation of DNA Damage Response

Clone

Cloning Information : 13999
HIP Master Clone ID : 28198
Original Clone ID : FLH013999.01L

Organism


TAX_ID : 9606
Species Specific ID: 836

Genome

Chromosome : 4
Map Location : 4q34
Ensembl : ENSG00000164305

Reagents

Labome : caspase-3-antibody