DNASU Plasmid Repository • 480.965.5697 | Email

FEN1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FEN1
Gene Name:  flap structure-specific endonuclease 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH058461.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000199

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1143nts         Open reading frame : 1 to 1143
Reference Sequence Alignment

ATGGGAATTCAAGGCCTGGCCAAACTAATTGCTGATGTGGCCCCCAGTGCCATCCGGGAG
AATGACATCAAGAGCTACTTTGGCCGTAAGGTGGCCATTGATGCCTCTATGAGCATTTAT
CAGTTCCTGATTGCTGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACC
ACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAG
CCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGC
AGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAG
CAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAG
TGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAG
GCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATG
GACTGCCTCACCTTCGGCAGCCCTGTGCTAATGCGACACCTGACTGCCAGTGAAGCCAAA
AAGCTGCCAATCCAGGAATTCCACCTGAGCCGGATTCTGCAGGAGCTGGGCCTGAACCAG
GAACAGTTTGTGGATCTGTGCATCCTGCTAGGCAGTGACTACTGTGAGAGTATCCGGGGT
ATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTG
CGGCGACTTGACCCCAACAAGTACCCTGTGCCAGAAAATTGGCTCCACAAGGAGGCTCAC
CAGCTCTTCTTGGAACCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGCGAG
CCAAATGAAGAAGAGCTGATCAAGTTCATGTGTGGTGAAAAGCAGTTCTCTGAGGAGCGA
ATCCGCAGTGGGGTCAAGAGGCTGAGTAAGAGCCGCCAAGGCAGCACCCAGGGCCGCCTG
GATGATTTCTTCAAGGTGACCGGCTCACTCTCTTCAGCTAAGCGCAAGGAGCCAGAACCC
AAGGGATCCACTAAGAAGAAGGCAAAGACTGGGGCAGCAGGGAAGTTTAAAAGGGGAAAA
TAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1510
Start on reference sequence 368
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FEN1
Symbol Nomenclature : FEN1
SYNONYM : FEN-1; MF1; RAD2
Designation : DNase IV|flap endonuclease 1|maturation factor 1|maturation factor-1
Full Nomenclature : flap structure-specific endonuclease 1
GENEID : 2237
GI : 60813576
GenBank Accession : AY893229
HGNC : 3650
MIM : 600393
Vega : OTTHUMG00000168162
Target GenBank: NM_004111

 

Reference Sequence Alignment

  

HsCD00000199      ATGGGAATTCAAGGCCTGGCCAAACTAATTGCTGATGTGGCCCCCAGTGCCATCCGGGAG
NM_004111.5       ATGGGAATTCAAGGCCTGGCCAAACTAATTGCTGATGTGGCCCCCAGTGCCATCCGGGAG
                  ************************************************************

HsCD00000199      AATGACATCAAGAGCTACTTTGGCCGTAAGGTGGCCATTGATGCCTCTATGAGCATTTAT
NM_004111.5       AATGACATCAAGAGCTACTTTGGCCGTAAGGTGGCCATTGATGCCTCTATGAGCATTTAT
                  ************************************************************

HsCD00000199      CAGTTCCTGATTGCTGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACC
NM_004111.5       CAGTTCCTGATTGCTGTTCGCCAGGGTGGGGATGTGCTGCAGAATGAGGAGGGTGAGACC
                  ************************************************************

HsCD00000199      ACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAG
NM_004111.5       ACCAGCCACCTGATGGGCATGTTCTACCGCACCATTCGCATGATGGAGAACGGCATCAAG
                  ************************************************************

HsCD00000199      CCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGC
NM_004111.5       CCCGTGTATGTCTTTGATGGCAAGCCGCCACAGCTCAAGTCAGGCGAGCTGGCCAAACGC
                  ************************************************************

HsCD00000199      AGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAG
NM_004111.5       AGTGAGCGGCGGGCTGAGGCAGAGAAGCAGCTGCAGCAGGCTCAGGCTGCTGGGGCCGAG
                  ************************************************************

HsCD00000199      CAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAG
NM_004111.5       CAGGAGGTGGAAAAATTCACTAAGCGGCTGGTGAAGGTCACTAAGCAGCACAATGATGAG
                  ************************************************************

HsCD00000199      TGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAG
NM_004111.5       TGCAAACATCTGCTGAGCCTCATGGGCATCCCTTATCTTGATGCACCCAGTGAGGCAGAG
                  ************************************************************

HsCD00000199      GCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATG
NM_004111.5       GCCAGCTGTGCTGCCCTGGTGAAGGCTGGCAAAGTCTATGCTGCGGCTACCGAGGACATG
                  ************************************************************

HsCD00000199      GACTGCCTCACCTTCGGCAGCCCTGTGCTAATGCGACACCTGACTGCCAGTGAAGCCAAA
NM_004111.5       GACTGCCTCACCTTCGGCAGCCCTGTGCTAATGCGACACCTGACTGCCAGTGAAGCCAAA
                  ************************************************************

HsCD00000199      AAGCTGCCAATCCAGGAATTCCACCTGAGCCGGATTCTGCAGGAGCTGGGCCTGAACCAG
NM_004111.5       AAGCTGCCAATCCAGGAATTCCACCTGAGCCGGATTCTGCAGGAGCTGGGCCTGAACCAG
                  ************************************************************

HsCD00000199      GAACAGTTTGTGGATCTGTGCATCCTGCTAGGCAGTGACTACTGTGAGAGTATCCGGGGT
NM_004111.5       GAACAGTTTGTGGATCTGTGCATCCTGCTAGGCAGTGACTACTGTGAGAGTATCCGGGGT
                  ************************************************************

HsCD00000199      ATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTG
NM_004111.5       ATTGGGCCCAAGCGGGCTGTGGACCTCATCCAGAAGCACAAGAGCATCGAGGAGATCGTG
                  ************************************************************

HsCD00000199      CGGCGACTTGACCCCAACAAGTACCCTGTGCCAGAAAATTGGCTCCACAAGGAGGCTCAC
NM_004111.5       CGGCGACTTGACCCCAACAAGTACCCTGTGCCAGAAAATTGGCTCCACAAGGAGGCTCAC
                  ************************************************************

HsCD00000199      CAGCTCTTCTTGGAACCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGCGAG
NM_004111.5       CAGCTCTTCTTGGAACCTGAGGTGCTGGACCCAGAGTCTGTGGAGCTGAAGTGGAGCGAG
                  ************************************************************

HsCD00000199      CCAAATGAAGAAGAGCTGATCAAGTTCATGTGTGGTGAAAAGCAGTTCTCTGAGGAGCGA
NM_004111.5       CCAAATGAAGAAGAGCTGATCAAGTTCATGTGTGGTGAAAAGCAGTTCTCTGAGGAGCGA
                  ************************************************************

HsCD00000199      ATCCGCAGTGGGGTCAAGAGGCTGAGTAAGAGCCGCCAAGGCAGCACCCAGGGCCGCCTG
NM_004111.5       ATCCGCAGTGGGGTCAAGAGGCTGAGTAAGAGCCGCCAAGGCAGCACCCAGGGCCGCCTG
                  ************************************************************

HsCD00000199      GATGATTTCTTCAAGGTGACCGGCTCACTCTCTTCAGCTAAGCGCAAGGAGCCAGAACCC
NM_004111.5       GATGATTTCTTCAAGGTGACCGGCTCACTCTCTTCAGCTAAGCGCAAGGAGCCAGAACCC
                  ************************************************************

HsCD00000199      AAGGGATCCACTAAGAAGAAGGCAAAGACTGGGGCAGCAGGGAAGTTTAAAAGGGGAAAA
NM_004111.5       AAGGGATCCACTAAGAAGAAGGCAAAGACTGGGGCAGCAGGGAAGTTTAAAAGGGGAAAA
                  ************************************************************

HsCD00000199      TAA
NM_004111.5       TAA
                  ***

Pathways

Reactome : Base Excision Repair
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA strand elongation
Reactome : Disease
Reactome : Early Phase of HIV Life Cycle
Reactome : Extension of Telomeres
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : Lagging Strand Synthesis
Reactome : Processive synthesis on the C-strand of the telomere
Reactome : Processive synthesis on the lagging strand
Reactome : Removal of DNA patch containing abasic residue
Reactome : Removal of the Flap Intermediate
Reactome : Removal of the Flap Intermediate from the C-strand
Reactome : Resolution of AP sites via the multiple-nucleotide patch replacement pathway
Reactome : Resolution of Abasic Sites (AP sites)
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance

Clone

Cloning Information : 58461
HIP Master Clone ID : 39021
Original Clone ID : FLH058461.01X

Organism


TAX_ID : 9606
Species Specific ID: 2237

Genome

Chromosome : 11
Map Location : 11q12
Ensembl : ENSG00000168496

Reagents

Labome : FEN1-antibody