DNASU Plasmid Repository • 480.965.5697 | Email

LCK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  LCK
Gene Name:  lymphocyte-specific protein tyrosine kinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000230.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00001994

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1620nts         Open reading frame : 1 to 1620
Reference Sequence Alignment

ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGT
GAGAACTGCCATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAAT
GGCTCTGAGGTGCGGGACCCACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCA
CTGCAAGACAACCTGGTTATCGCTCTGCACAGCTATGAGCCCTCTCACGACGGAGATCTG
GGCTTTGAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGAGCGGCGAGTGGTGGAAGGCG
CAGTCCCTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGCCAAAGCGAAC
AGCCTGGAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAG
CTCCTGGCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCG
GGATCGTTTTCACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACAT
TACAAGATCCGTAATCTGGACAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCC
GGCCTGCATGAACTGGTCCGCCATTACACCAATGCTTCAGATGGGCTGTGCACACGGTTG
AGCCGCCCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGTGGGAGGACGAGTGGGAGGTT
CCCAGGGAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGGGGAGGTGTGG
ATGGGGTACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATG
TCCCCGGACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTG
GTTCGGCTCTACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAG
AATGACACACTTCTAGACTCCCAGTTGGAGGAGAAAGGTCTGGGGGCCTCCCCCTGGGGC
AACTTGGGCCAGCAACTCTTGCTTCTGCCCACAGGGAGTCTAGTGGATTTTCTCAAGACC
CCTTCAGGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAA
GGCATGGCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATT
CTGGTGTCTGACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAG
GACAACGAGTACACAGCCAGGGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAA
GCCATTAACTACGGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTG
ACGGAAATTGTCACCCACGGCCGCATCCCTTACCCAGGGATGACCAACCCGGAGGTGATT
CAGAACCTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGAGGAGCTGTAC
CAACTCATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTG
CGCAGTGTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1720
Start on reference sequence 101
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : LCK
Symbol Nomenclature : LCK
SYNONYM : LSK; YT16; p56lck; pp58lck
Designation : T-lymphocyte specific protein tyrosine kinase p56lck|leukocyte C-terminal Src kinase|lymphocyte cell-specific protein-tyrosine kinase|p56(LSTRA) protein-tyrosine kinase|proto-oncogene tyrosine-protein kinase LCK|t cell-specific protein-tyrosine kinase|tyrosine-protein kinase Lck
Full Nomenclature : lymphocyte-specific protein tyrosine kinase
GENEID : 3932
Locus Tag : RP4-675E8.4
GI : 33303798
GenBank Accession : AY335586
HGNC : 6524
MIM : 153390
Vega : OTTHUMG00000007463
Target GenBank: BC013200

 

Reference Sequence Alignment

  

HsCD00001994        ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGT
XM_005270863.1      ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGT
XM_005270862.1      ATGGGCTGTGGCTGCAGCTCACACCCGGAAGATGACTGGATGGAAAACATCGATGTGTGT
                    ************************************************************

HsCD00001994        GAGAACTGCCATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAAT
XM_005270863.1      GAGAACTGCCATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAAT
XM_005270862.1      GAGAACTGCCATTATCCCATAGTCCCACTGGATGGCAAGGGCACGCTGCTCATCCGAAAT
                    ************************************************************

HsCD00001994        GGCTCTGAGGTGCGGGACCCACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCA
XM_005270863.1      GGCTCTGAGGTGCGGGACCCACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCA
XM_005270862.1      GGCTCTGAGGTGCGGGACCCACTGGTTACCTACGAAGGCTCCAATCCGCCGGCTTCCCCA
                    ************************************************************

HsCD00001994        CTGCAAG-----------------------------------------------------
XM_005270863.1      CTGCAAGGTGACCCCAGGCAGCAGGGCCTGAAAGACAAGGCCTGCGGATCCCTGGCTGTT
XM_005270862.1      CTGCAAGGTGACCCCAGGCAGCAGGGCCTGAAAGACAAGGCCTGCGGATCCCTGGCTGTT
                    *******                                                     

HsCD00001994        ------------------------------------------------------------
XM_005270863.1      GGCTTCCACCTCTCCCCCACCTACTTTCTCCCCGGTCTTGCCTTCCTTGTCCCCCACCCT
XM_005270862.1      GGCTTCCACCTCTCCCCCACCTACTTTCTCCCCGGTCTTGCCTTCCTTGTCCCCCACCCT
                                                                                

HsCD00001994        ------------------------------------------------------------
XM_005270863.1      GTAACTCCAGGCTTCCTGCCGATCCCAGCTCGGTTCTCCCTGATGCCCCTTGTCTTTACA
XM_005270862.1      GTAACTCCAGGCTTCCTGCCGATCCCAGCTCGGTTCTCCCTGATGCCCCTTGTCTTTACA
                                                                                

HsCD00001994        -ACAACCTGGTTATCGCTCTGCACAGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTT
XM_005270863.1      GACAACCTGGTTATCGCTCTGCACAGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTT
XM_005270862.1      GACAACCTGGTTATCGCTCTGCACAGCTATGAGCCCTCTCACGACGGAGATCTGGGCTTT
                     ***********************************************************

HsCD00001994        GAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGAGCGGCGAGTGGTGGAAGGCGCAGTCC
XM_005270863.1      GAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGAGCGGCGAGTGGTGGAAGGCGCAGTCC
XM_005270862.1      GAGAAGGGGGAACAGCTCCGCATCCTGGAGCAGAGCGGCGAGTGGTGGAAGGCGCAGTCC
                    ************************************************************

HsCD00001994        CTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGCCAAAGCGAACAGCCTG
XM_005270863.1      CTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGCCAAAGCGAACAGCCTG
XM_005270862.1      CTGACCACGGGCCAGGAAGGCTTCATCCCCTTCAATTTTGTGGCCAAAGCGAACAGCCTG
                    ************************************************************

HsCD00001994        GAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAGCTCCTG
XM_005270863.1      GAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAGCTCCTG
XM_005270862.1      GAGCCCGAACCCTGGTTCTTCAAGAACCTGAGCCGCAAGGACGCGGAGCGGCAGCTCCTG
                    ************************************************************

HsCD00001994        GCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGATCG
XM_005270863.1      GCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGATCG
XM_005270862.1      GCGCCCGGGAACACTCACGGCTCCTTCCTCATCCGGGAGAGCGAGAGCACCGCGGGATCG
                    ************************************************************

HsCD00001994        TTTTCACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAG
XM_005270863.1      TTTTCACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAG
XM_005270862.1      TTTTCACTGTCGGTCCGGGACTTCGACCAGAACCAGGGAGAGGTGGTGAAACATTACAAG
                    ************************************************************

HsCD00001994        ATCCGTAATCTGGACAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTG
XM_005270863.1      ATCCGTAATCTGGACAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTG
XM_005270862.1      ATCCGTAATCTGGACAACGGTGGCTTCTACATCTCCCCTCGAATCACTTTTCCCGGCCTG
                    ************************************************************

HsCD00001994        CATGAACTGGTCCGCCATTACACCAATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGC
XM_005270863.1      CATGAACTGGTCCGCCATTACACCAATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGC
XM_005270862.1      CATGAACTGGTCCGCCATTACACCAATGCTTCAGATGGGCTGTGCACACGGTTGAGCCGC
                    ************************************************************

HsCD00001994        CCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGTGGGAGGACGAGTGGGAGGTTCCCAGG
XM_005270863.1      CCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGTGGGAGGACGAGTGGGAGGTTCCCAGG
XM_005270862.1      CCCTGCCAGACCCAGAAGCCCCAGAAGCCGTGGTGGGAGGACGAGTGGGAGGTTCCCAGG
                    ************************************************************

HsCD00001994        GAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGGGGAGGTGTGGATGGGG
XM_005270863.1      GAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGGGGAGGTGTGGATGGGG
XM_005270862.1      GAGACGCTGAAGCTGGTGGAGCGGCTGGGGGCTGGACAGTTCGGGGAGGTGTGGATGGGG
                    ************************************************************

HsCD00001994        TACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATGTCCCCG
XM_005270863.1      TACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATGTCCCCG
XM_005270862.1      TACTACAACGGGCACACGAAGGTGGCGGTGAAGAGCCTGAAGCAGGGCAGCATGTCCCCG
                    ************************************************************

HsCD00001994        GACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTGGTTCGG
XM_005270863.1      GACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTGGTTCGG
XM_005270862.1      GACGCCTTCCTGGCCGAGGCCAACCTCATGAAGCAGCTGCAACACCAGCGGCTGGTTCGG
                    ************************************************************

HsCD00001994        CTCTACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAATGAC
XM_005270863.1      CTCTACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAAT---
XM_005270862.1      CTCTACGCTGTGGTCACCCAGGAGCCCATCTACATCATCACTGAATACATGGAGAAT---
                    *********************************************************   

HsCD00001994        ACACTTCTAGACTCCCAGTTGGAGGAGAAAGGTCTGGGGGCCTCCCCCTGGGGCAACTTG
XM_005270863.1      ------------------------------------------------------------
XM_005270862.1      ------------------------------------------------------------
                                                                                

HsCD00001994        GGCCAGCAACTCTTGCTTCTGCCCACAGGGAGTCTAGTGGATTTTCTCAAGACCCCTTCA
XM_005270863.1      ---------------------------GGGAGTCTAGTGGATTTTCTCAAGACCCCTTCA
XM_005270862.1      ---------------------------GGGAGTCTAGTGGATTTTCTCAAGACCCCTTCA
                                               *********************************

HsCD00001994        GGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAAGGCATG
XM_005270863.1      GGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAAGGCATG
XM_005270862.1      GGCATCAAGTTGACCATCAACAAACTCCTGGACATGGCAGCCCAAATTGCAGAAGGCATG
                    ************************************************************

HsCD00001994        GCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATTCTGGTG
XM_005270863.1      GCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATTCTGGTG
XM_005270862.1      GCATTCATTGAAGAGCGGAATTATATTCATCGTGACCTTCGGGCTGCCAACATTCTGGTG
                    ************************************************************

HsCD00001994        TCTGACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGACAAC
XM_005270863.1      TCTGACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGACAAC
XM_005270862.1      TCTGACACCCTGAGCTGCAAGATTGCAGACTTTGGCCTAGCACGCCTCATTGAGGACAAC
                    ************************************************************

HsCD00001994        GAGTACACAGCCAGGGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATT
XM_005270863.1      GAGTACACAGCCAGGGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATT
XM_005270862.1      GAGTACACAGCCAGGGAGGGGGCCAAGTTTCCCATTAAGTGGACAGCGCCAGAAGCCATT
                    ************************************************************

HsCD00001994        AACTACGGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAA
XM_005270863.1      AACTACGGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAA
XM_005270862.1      AACTACGGGACATTCACCATCAAGTCAGATGTGTGGTCTTTTGGGATCCTGCTGACGGAA
                    ************************************************************

HsCD00001994        ATTGTCACCCACGGCCGCATCCCTTACCCAGGGATGACCAACCCGGAGGTGATTCAGAAC
XM_005270863.1      ATTGTCACCCACGGCCGCATCCCTTACCCAGGGATGACCAACCCGGAGGTGATTCAGAAC
XM_005270862.1      ATTGTCACCCACGGCCGCATCCCTTACCCAGGGATGACCAACCCGGAGGTGATTCAGAAC
                    ************************************************************

HsCD00001994        CTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGAGGAGCTGTACCAACTC
XM_005270863.1      CTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGAGGAGCTGTACCAACTC
XM_005270862.1      CTGGAGCGAGGCTACCGCATGGTGCGCCCTGACAACTGTCCAGAGGAGCTGTACCAACTC
                    ************************************************************

HsCD00001994        ATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTGCGCAGT
XM_005270863.1      ATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTGCGCAGT
XM_005270862.1      ATGAGGCTGTGCTGGAAGGAGCGCCCAGAGGACCGGCCCACCTTTGACTACCTGCGCAGT
                    ************************************************************

HsCD00001994        GTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCTTTG
XM_005270863.1      GTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCTTGA
XM_005270862.1      GTGCTGGAGGACTTCTTCACGGCCACAGAGGGCCAGTACCAGCCTCAGCCTTGA
                    **************************************************** .

Pathways

NCI : Alpha-synuclein signaling
NCI : Atypical NF-kappaB pathway
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EPHA forward signaling
NCI : Ephrin B reverse signaling
NCI : Glypican 1 network
NCI : IL12-mediated signaling events
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : SHP2 signaling
NCI : Signaling events mediated by PTP1B
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Parkinson disease
Panther : T cell activation
Reactome : Adaptive Immune System
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CD28 dependent Vav1 pathway
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream TCR signaling
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : GPVI-mediated activation cascade
Reactome : Generation of second messenger molecules
Reactome : HIV Infection
Reactome : Hemostasis
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-2 signaling
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nef Mediated CD4 Down-regulation
Reactome : Nef and signal transduction
Reactome : Nef-mediates down modulation of cell surface receptors by recruiting them to clathrin adapters
Reactome : PD-1 signaling
Reactome : PECAM1 interactions
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Phosphorylation of CD3 and TCR zeta chains
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TCR signaling
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
Reactome : Translocation of ZAP-70 to Immunological synapse
WikiPathway : IL-2 Signaling pathway
WikiPathway : Inflammatory Response Pathway
WikiPathway : Notch Signaling Pathway

Clone

Cloning Information : 230
HIP Master Clone ID : 87349
Original Clone ID : FLH000230.01L

Organism


TAX_ID : 9606
Species Specific ID: 3932

Genome

Chromosome : 1
Map Location : 1p34.3
Ensembl : ENSG00000182866

Reagents

Labome : Lck-antibody