DNASU Plasmid Repository • 480.965.5697 | Email

RFC3 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RFC3
Gene Name:  replication factor C (activator 1) 3, 38kDa
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH054938.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000002

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1071nts         Open reading frame : 1 to 1071
Reference Sequence Alignment

ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAG
GAGCAGGCGGCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTG
TACGGACCATCAGGTGCTGGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTAT
GGCGTTGGAGTGGAAAAATTGAGAATTGAACATCAGACCATCACAACTCCATCTAAAAAA
AAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTGAAGTTAATCCTAGTGATGCT
GGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACAATCACAACAA
CTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGA
TTGATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTG
GCGGTTCGTGTGCCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGT
AAGAAGGAAGGTCTGAATCTTCCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGT
AGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCAGAGTGCAACAATATCCTTTT
ACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGAGACTGCAAAT
GCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGGCCTTCTCTCAGAACTGTTA
CATAATTGTGATGGACAACTGAAAGGGGAGGTGGCACAAATGGCAGCTTACTATGAGCAT
CGTCTACAGCTGGGTAGCAAAGCCATTTATCACTTGGAAGCGTTTGTGGCCAAATTCATG
GCACTTTATAAGAAGTTCATGGAGGATGGATTGGAAGGCATGATGTTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1080
Start on reference sequence 10
Mutations:
None
Discrepancy:
t166c; t183c
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RFC3
Symbol Nomenclature : RFC3
SYNONYM : RFC38
Designation : A1 38 kDa subunit|RF-C 38 kDa subunit|RFC, 38 kD subunit|activator 1 38 kDa subunit|activator 1 subunit 3|replication factor C 38 kDa subunit|replication factor C subunit 3
Full Nomenclature : replication factor C (activator 1) 3, 38kDa
GENEID : 5983
GI : 60812372
GenBank Accession : AY893172
HGNC : 9971
MIM : 600405
Vega : OTTHUMG00000016715
Target GenBank: NM_002915

 

Reference Sequence Alignment

  

HsCD00000002      ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAG
NM_002915.3       ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAG
                  ************************************************************

HsCD00000002      GAGCAGGCGGCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTG
NM_002915.3       GAGCAGGCGGCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTG
                  ************************************************************

HsCD00000002      TACGGACCATCAGGTGCTGGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTAT
NM_002915.3       TACGGACCATCAGGTGCTGGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTAT
                  ************************************************************

HsCD00000002      GGCGTTGGAGTGGAAAAATTGAGAATTGAACATCAGACCATCACAACTCCATCTAAAAAA
NM_002915.3       GGTGTTGGAGTGGAAAAATTGAGAATTGAACATCAGACCATCACAACTCCATCTAAAAAA
                  ** *********************************************************

HsCD00000002      AAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTGAAGTTAATCCTAGTGATGCT
NM_002915.3       AAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTGAAGTTAATCCTAGTGATGCT
                  ************************************************************

HsCD00000002      GGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACAATCACAACAA
NM_002915.3       GGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACAATCACAACAA
                  ************************************************************

HsCD00000002      CTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
NM_002915.3       CTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
                  ************************************************************

HsCD00000002      ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGA
NM_002915.3       ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGA
                  ************************************************************

HsCD00000002      TTGATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTG
NM_002915.3       TTGATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTG
                  ************************************************************

HsCD00000002      GCGGTTCGTGTGCCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGT
NM_002915.3       GCGGTTCGTGTGCCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGT
                  ************************************************************

HsCD00000002      AAGAAGGAAGGTCTGAATCTTCCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGT
NM_002915.3       AAGAAGGAAGGTCTGAATCTTCCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGT
                  ************************************************************

HsCD00000002      AGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCAGAGTGCAACAATATCCTTTT
NM_002915.3       AGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCAGAGTGCAACAATATCCTTTT
                  ************************************************************

HsCD00000002      ACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGAGACTGCAAAT
NM_002915.3       ACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGAGACTGCAAAT
                  ************************************************************

HsCD00000002      GCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
NM_002915.3       GCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
                  ************************************************************

HsCD00000002      CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGGCCTTCTCTCAGAACTGTTA
NM_002915.3       CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGGCCTTCTCTCAGAACTGTTA
                  ************************************************************

HsCD00000002      CATAATTGTGATGGACAACTGAAAGGGGAGGTGGCACAAATGGCAGCTTACTATGAGCAT
NM_002915.3       CATAATTGTGATGGACAACTGAAAGGGGAGGTGGCACAAATGGCAGCTTACTATGAGCAT
                  ************************************************************

HsCD00000002      CGTCTACAGCTGGGTAGCAAAGCCATTTATCACTTGGAAGCGTTTGTGGCCAAATTCATG
NM_002915.3       CGTCTACAGCTGGGTAGCAAAGCCATTTATCACTTGGAAGCGTTTGTGGCCAAATTCATG
                  ************************************************************

HsCD00000002      GCACTTTATAAGAAGTTCATGGAGGATGGATTGGAAGGCATGATGTTCTAG
NM_002915.3       GCACTTTATAAGAAGTTCATGGAGGATGGATTGGAAGGCATGATGTTCTGA
                  *************************************************..

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA strand elongation
Reactome : Extension of Telomeres
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : Lagging Strand Synthesis
Reactome : Leading Strand Synthesis
Reactome : Nucleotide Excision Repair
Reactome : Polymerase switching
Reactome : Polymerase switching on the C-strand of the telomere
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication

Protein

SMART domain : AAA : ATPases associated with a variety of cellular activities
UniProt : C9JU95
UniProt : P40938
HPRD : 02676

Clone

Cloning Information : 54938
HIP Master Clone ID : 13216
Original Clone ID : FLH054938.01X

Organism


TAX_ID : 9606
Species Specific ID: 5983

Genome

Chromosome : 13
Map Location : 13q13.2
Ensembl : ENSG00000133119

Reagents

Labome : RFC3-antibody