DNASU Plasmid Repository • 480.965.5697 | Email

PRL (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRL
Gene Name:  prolactin
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH057831.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000020

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 684nts         Open reading frame : 1 to 684
Reference Sequence Alignment

ATGAACATCAAAGGATCGCCATGGAAAGGGTCCCTCCTGCTGCTGCTGGTGTCAAACCTG
CTCCTGTGCCAGAGCGTGGCCCCCTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAG
GTGACCCTTCGAGACCTGTTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTC
TCCTCAGAAATGTTCAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACC
AAGGCCATCAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCC
CAACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGGAAT
GAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCGGAGGCTATC
CTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTAGAGGGCATGGAGCTG
ATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAGATCTACCCTGTCTGGTCGGGA
CTTCCATCCCTGCAGATGGCTGATGAAGAGTCTCGCCTTTCTGCTTATTATAACCTGCTC
CACTGCCTACGCAGGGATTCACATAAAATCGACAATTATCTCAAGCTCCTGAAGTGCCGA
ATCATCCACAACAACAACTGCTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 688
Start on reference sequence 5
Mutations:
None
Discrepancy:
g63c
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRL
Symbol Nomenclature : PRL
Designation : decidual prolactin
Full Nomenclature : prolactin
GENEID : 5617
Locus Tag : RP3-404K8.1
GI : 60812489
GenBank Accession : AY893177
HGNC : 9445
MIM : 176760
Vega : OTTHUMG00000016111
Target GenBank: NM_000948

 

Reference Sequence Alignment

  

HsCD00000020        ATGAACATCAAAGGATCGCCATGGAAAGGGTCCCTCCTGCTGCTGCTGGTGTCAAACCTG
NM_000948.5         ATGAACATCAAAGGATCGCCATGGAAAGGGTCCCTCCTGCTGCTGCTGGTGTCAAACCTG
NM_001163558.2      ATGAACATCAAAGGATCGCCATGGAAAGGGTCCCTCCTGCTGCTGCTGGTGTCAAACCTG
                    ************************************************************

HsCD00000020        CTCCTGTGCCAGAGCGTGGCCCCCTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAG
NM_000948.5         CTCCTGTGCCAGAGCGTGGCCCCCTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAG
NM_001163558.2      CTCCTGTGCCAGAGCGTGGCCCCCTTGCCCATCTGTCCCGGCGGGGCTGCCCGATGCCAG
                    ************************************************************

HsCD00000020        GTGACCCTTCGAGACCTGTTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTC
NM_000948.5         GTGACCCTTCGAGACCTGTTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTC
NM_001163558.2      GTGACCCTTCGAGACCTGTTTGACCGCGCCGTCGTCCTGTCCCACTACATCCATAACCTC
                    ************************************************************

HsCD00000020        TCCTCAGAAATGTTCAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACC
NM_000948.5         TCCTCAGAAATGTTCAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACC
NM_001163558.2      TCCTCAGAAATGTTCAGCGAATTCGATAAACGGTATACCCATGGCCGGGGGTTCATTACC
                    ************************************************************

HsCD00000020        AAGGCCATCAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCC
NM_000948.5         AAGGCCATCAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCC
NM_001163558.2      AAGGCCATCAACAGCTGCCACACTTCTTCCCTTGCCACCCCCGAAGACAAGGAGCAAGCC
                    ************************************************************

HsCD00000020        CAACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGGAAT
NM_000948.5         CAACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGGAAT
NM_001163558.2      CAACAGATGAATCAAAAAGACTTTCTGAGCCTGATAGTCAGCATATTGCGATCCTGGAAT
                    ************************************************************

HsCD00000020        GAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCGGAGGCTATC
NM_000948.5         GAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCGGAGGCTATC
NM_001163558.2      GAGCCTCTGTATCATCTGGTCACGGAAGTACGTGGTATGCAAGAAGCCCCGGAGGCTATC
                    ************************************************************

HsCD00000020        CTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTAGAGGGCATGGAGCTG
NM_000948.5         CTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTAGAGGGCATGGAGCTG
NM_001163558.2      CTATCCAAAGCTGTAGAGATTGAGGAGCAAACCAAACGGCTTCTAGAGGGCATGGAGCTG
                    ************************************************************

HsCD00000020        ATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAGATCTACCCTGTCTGGTCGGGA
NM_000948.5         ATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAGATCTACCCTGTCTGGTCGGGA
NM_001163558.2      ATAGTCAGCCAGGTTCATCCTGAAACCAAAGAAAATGAGATCTACCCTGTCTGGTCGGGA
                    ************************************************************

HsCD00000020        CTTCCATCCCTGCAGATGGCTGATGAAGAGTCTCGCCTTTCTGCTTATTATAACCTGCTC
NM_000948.5         CTTCCATCCCTGCAGATGGCTGATGAAGAGTCTCGCCTTTCTGCTTATTATAACCTGCTC
NM_001163558.2      CTTCCATCCCTGCAGATGGCTGATGAAGAGTCTCGCCTTTCTGCTTATTATAACCTGCTC
                    ************************************************************

HsCD00000020        CACTGCCTACGCAGGGATTCACATAAAATCGACAATTATCTCAAGCTCCTGAAGTGCCGA
NM_000948.5         CACTGCCTACGCAGGGATTCACATAAAATCGACAATTATCTCAAGCTCCTGAAGTGCCGA
NM_001163558.2      CACTGCCTACGCAGGGATTCACATAAAATCGACAATTATCTCAAGCTCCTGAAGTGCCGA
                    ************************************************************

HsCD00000020        ATCATCCACAACAACAACTGCTAA
NM_000948.5         ATCATCCACAACAACAACTGCTAA
NM_001163558.2      ATCATCCACAACAACAACTGCTAA
                    ************************

Pathways

NCI : ErbB4 signaling events
NCI : Glucocorticoid receptor regulatory network
NCI : Signaling events mediated by PTP1B
NCI : Validated nuclear estrogen receptor alpha network
Reactome : Amyloids
Reactome : Cytokine Signaling in Immune system
Reactome : Disease
Reactome : Growth hormone receptor signaling
Reactome : Immune System
Reactome : Nuclear signaling by ERBB4
Reactome : Prolactin receptor signaling
Reactome : Signal Transduction
Reactome : Signaling by ERBB4
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Prostaglandin Synthesis and Regulation

Protein

UniProt : Q5THQ0
UniProt : P01236
HPRD : 07180

Clone

Cloning Information : 57831
HIP Master Clone ID : 36119
Original Clone ID : FLH057831.01X

Organism


TAX_ID : 9606
Species Specific ID: 5617

Genome

Chromosome : 6
Map Location : 6p22.3
Ensembl : ENSG00000172179

Reagents

Labome : prolactin-antibody