DNASU Plasmid Repository • 480.965.5697 | Email

ITGB1 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  SLC38A10
Gene Name:  solute carrier family 38, member 10
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056217.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 582nts         Open reading frame : 1 to 582
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2115
Start on reference sequence 1534
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : SLC38A10
Symbol Nomenclature : SLC38A10
Designation : putative sodium-coupled neutral amino acid transporter 10
Full Nomenclature : solute carrier family 38, member 10
GENEID : 124565
Locus Tag : PP1744
GI : 60813613
GenBank Accession : AY893231
HGNC : 28237
Vega : OTTHUMG00000168049
Target GenBank: BC009469


Reference Sequence Alignment


HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------
NM_001037984.2      AACCAGGCGGCCAGCCAGCTGGAG------------------------GAAGCTGGCAGG

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ------------------------------------------------------------

HsCD00000204        ---------------------------------------ATGAAGCCCAAGCAAGTGAGC







                    ***************************************************   .*****





NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Arf6 trafficking events
NCI : Beta1 integrin cell surface interactions
NCI : CXCR4-mediated signaling events
NCI : Integrin family cell surface interactions
NCI : Plexin-D1 Signaling
NCI : Reelin signaling pathway
NCI : RhoA signaling pathway
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by focal adhesion kinase
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-4-mediated signaling events
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : Validated targets of C-MYC transcriptional repression
NCI : a4b7 Integrin signaling
NCI : a6b1 and a6b4 Integrin signaling
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Basigin interactions
Reactome : CHL1 interactions
Reactome : Cell junction organization
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Cell-extracellular matrix interactions
Reactome : Developmental Biology
Reactome : ECM proteoglycans
Reactome : Elastic fibre formation
Reactome : Extracellular matrix organization
Reactome : Fibronectin matrix formation
Reactome : Hemostasis
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Integrin cell surface interactions
Reactome : L1CAM interactions
Reactome : Laminin interactions
Reactome : Localization of the PINCH-ILK-PARVIN complex to focal adhesions
Reactome : Molecules associated with elastic fibres
Reactome : Non-integrin membrane-ECM interactions
Reactome : Other semaphorin interactions
Reactome : Platelet Adhesion to exposed collagen
Reactome : Semaphorin interactions
Reactome : Signal transduction by L1
Reactome : Syndecan interactions
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Neural Crest Differentiation
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TGF beta Signaling Pathway


UniProt : P05556
HPRD : 17506


Cloning Information : 56217
HIP Master Clone ID : 34081
Original Clone ID : FLH056217.01X


TAX_ID : 9606
Species Specific ID: 3688


Chromosome : 17
Map Location : 17q25.3
Ensembl : ENSG00000157637


Labome : beta1-integrin-antibody