DNASU Plasmid Repository • 480.965.5697 | Email

ITGB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLC38A10
Gene Name:  solute carrier family 38, member 10
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH117891.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00000205

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 582nts         Open reading frame : 1 to 582
Reference Sequence Alignment

ATGAAGCCCAAGCAAGTGAGCCGAGACCTGGGCCTTGCAGCGGACCTGCCCGGTGGGGCG
GAAGGAGCAGCTGCACAGCCCCAGGCTGTGTTACGCCAGCCGGAACTGCGGGTCATCTCT
GATGGCGAGCAGGGTGGACAGCAGGGCCACCGGCTGGACCATGGCGGTCACCTGGAGATG
AGAAAGGCCCGCGGGGGGGACCATGTGCCTGTGTCCCACGAGCAGCCGAGAGGCGGGGAG
GACGCTGCTGTCCAGGAGCCCAGGCAGAGGCCAGAGCCAGAGCTGGGGCTCAAACGAGCT
GTCCCGGGGGGCCAGAGGCCGGACAATGCCAAGCCCAACCGGGACCTGAAACTGCAGGCT
GGCTCCGACCTCCGGAGGCGACGGCGGGACCTTGGCCCTCATGCAGAGGGTCAGCTGGCC
CCGAGGGATGGGGTCATTGGCCTTAACCCCCTGCCTGATGTCCAGGTGAACGACCTCCGT
GGCGCCCTGGATGCCCAGCTCCGCCAGGCTGCGGGGGGAGCTCTGCAGGTGGTCCACAGC
CGGCAGCTTAGACAGGCGCCTGGGCCTCCAGAGGAGTCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2115
Start on reference sequence 1534
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLC38A10
Symbol Nomenclature : SLC38A10
Designation : putative sodium-coupled neutral amino acid transporter 10
Full Nomenclature : solute carrier family 38, member 10
GENEID : 124565
Locus Tag : PP1744
GI : 61365253
GenBank Accession : AY890737
HGNC : 28237
Vega : OTTHUMG00000168049
Target GenBank: BC009469

 

Reference Sequence Alignment

  

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      ATGACCGCGGCCGCCGCCTCCAACTGGGGGCTGATCACGAACATCGTGAACAGCATCGTA
XM_005257019.1      ATGACCGCGGCCGCCGCCTCCAACTGGGGGCTGATCACGAACATCGTGAACAGCATCGTA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GGGGTCAGTGTCCTCACCATGCCCTTCTGCTTCAAACAGTGCGGCATCGTCCTGGGGGCG
XM_005257019.1      GGGGTCAGTGTCCTCACCATGCCCTTCTGCTTCAAACAGTGCGGCATCGTCCTGGGGGCG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CTGCTCTTGGTCTTCTGCTCATGGATGACGCACCAGTCGTGCATGTTCTTGGTGAAGTCG
XM_005257019.1      CTGCTCTTGGTCTTCTGCTCATGGATGACGCACCAGTCGTGCATGTTCTTGGTGAAGTCG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GCCAGCCTGAGCAAGCGGAGGACCTACGCCGGCCTGGCATTCCACGCCTACGGGAAGGCA
XM_005257019.1      GCCAGCCTGAGCAAGCGGAGGACCTACGCCGGCCTGGCATTCCACGCCTACGGGAAGGCA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GGCAAGATGCTGGTGGAGACCAGCATGATCGGGCTGATGCTGGGCACCTGCATCGCCTTC
XM_005257019.1      GGCAAGATGCTGGTGGAGACCAGCATGATCGGGCTGATGCTGGGCACCTGCATCGCCTTC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TACGTCGTGATCGGCGACTTGGGGTCCAACTTCTTTGCCCGGCTGTTCGGGTTTCAGGTG
XM_005257019.1      TACGTCGTGATCGGCGACTTGGGGTCCAACTTCTTTGCCCGGCTGTTCGGGTTTCAGGTG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GGCGGCACCTTCCGCATGTTCCTGCTGTTCGCCGTGTCGCTGTGCATCGTGCTCCCGCTC
XM_005257019.1      GGCGGCACCTTCCGCATGTTCCTGCTGTTCGCCGTGTCGCTGTGCATCGTGCTCCCGCTC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AGCCTGCAGCGGAACATGATGGCCTCCATCCAGTCCTTCAGCGCCATGGCCCTCCTCTTC
XM_005257019.1      AGCCTGCAGCGGAACATGATGGCCTCCATCCAGTCCTTCAGCGCCATGGCCCTCCTCTTC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TACACCGTGTTCATGTTCGTGATCGTGCTCTCCTCTCTCAAGCACGGCCTCTTCAGTGGG
XM_005257019.1      TACACCGTGTTCATGTTCGTGATCGTGCTCTCCTCTCTCAAGCACGGCCTCTTCAGTGGG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CAGTGGCTGCGGCGGGTCAGCTACGTCCGCTGGGAGGGCGTCTTCCGCTGCATCCCCATC
XM_005257019.1      CAGTGGCTGCGGCGGGTCAGCTACGTCCGCTGGGAGGGCGTCTTCCGCTGCATCCCCATC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TTCGGCATGTCCTTCGCCTGCCAGTCCCAGGTGCTGCCCACCTACGACAGCCTGGATGAG
XM_005257019.1      TTCGGCATGTCCTTCGCCTGCCAGTCCCAGGTGCTGCCCACCTACGACAGCCTGGATGAG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CCGTCAGTGAAAACCATGAGCTCCATATTTGCTTCCTCCCTTAATGTGGTCACCACCTTC
XM_005257019.1      CCGTCAGTGAAAACCATGAGCTCCATATTTGCTTCCTCCCTTAATGTGGTCACCACCTTC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TACGTCATGGTGGGGTTTTTCGGCTACGTCAGCTTCACCGAGGCCACGGCCGGCAACGTG
XM_005257019.1      TACGTCATGGTGGGGTTTTTCGGCTACGTCAGCTTCACCGAGGCCACGGCCGGCAACGTG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CTCATGCACTTTCCCTCCAACCTGGTGACGGAGATGCTCCGTGTGGGCTTCATGATGTCA
XM_005257019.1      CTCATGCACTTTCCCTCCAACCTGGTGACGGAGATGCTCCGTGTGGGCTTCATGATGTCA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GTGGCTGTGGGCTTCCCCATGATGATCCTGCCATGCAGGCAGGCCCTGAGCACGCTGCTG
XM_005257019.1      GTGGCTGTGGGCTTCCCCATGATGATCCTGCCATGCAGGCAGGCCCTGAGCACGCTGCTG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TGTGAGCAGCAGCAAAAAGATGGCACCTTTGCAGCAGGGGGCTACATGCCCCCTCTCCGG
XM_005257019.1      TGTGAGCAGCAGCAAAAAGATGGCACCTTTGCAGCAGGGGGCTACATGCCCCCTCTCCGG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TTTAAAGCACTTACCCTCTCTGTGGTGTTTGGAACCATGGTTGGTGGCATCCTTATCCCC
XM_005257019.1      TTTAAAGCACTTACCCTCTCTGTGGTGTTTGGAACCATGGTTGGTGGCATCCTTATCCCC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AACGTGGAGACCATCCTGGGCCTCACAGGAGCGACCATGGGAAGCCTCATCTGCTTCATC
XM_005257019.1      AACGTGGAGACCATCCTGGGCCTCACAGGAGCGACCATGGGAAGCCTCATCTGCTTCATC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TGCCCGGCGCTGATCTACAAGAAAATCCACAAGAACGCACTTTCCTCCCAGGTGGTGCTG
XM_005257019.1      TGCCCGGCGCTGATCTACAAGAAAATCCACAAGAACGCACTTTCCTCCCAGGTGGTGCTG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      TGGGTCGGCCTGGGCGTCCTGGTGGTGAGCACTGTCACCACACTGTCTGTGAGCGAGGAG
XM_005257019.1      TGGGTCGGCCTGGGCGTCCTGGTGGTGAGCACTGTCACCACACTGTCTGTGAGCGAGGAG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GTCCCCGAGGACTTGGCAGAGGAAGCCCCTGGCGGCCGGCTTGGAGAGGCCGAGGGTTTG
XM_005257019.1      GTCCCCGAGGACTTGGCAGAGGAAGCCCCTGGCGGCCGGCTTGGAGAGGCCGAGGGTTTG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      ATGAAGGTGGAGGCAGCGCGGCTCTCAGCCCAGGATCCGGTTGTGGCCGTGGCTGAGGAT
XM_005257019.1      ATGAAGGTGGAGGCAGCGCGGCTCTCAGCCCAGGATCCGGTTGTGGCCGTGGCTGAGGAT
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GGCCGGGAGAAGCCGAAGCTGCCGAAGGAGAGAGAGGAGCTGGAGCAGGCCCAGATCAAG
XM_005257019.1      GGCCGGGAGAAGCCGAAGCTGCCGAAGGAGAGAGAGGAGCTGGAGCAGGCCCAGATCAAG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GGGCCCGTGGATGTGCCTGGACGGGAAGATGGCAAGGAGGCACCGGAGGAGGCACAGCTC
XM_005257019.1      GGGCCCGTGGATGTGCCTGGACGGGAAGATGGCAAGGAGGCACCGGAGGAGGCACAGCTC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GATCGCCCTGGGCAAGGGATTGCTGTGCCTGTGGGCGAGGCCCACCGCCACGAGCCTCCT
XM_005257019.1      GATCGCCCTGGGCAAGGGATTGCTGTGCCTGTGGGCGAGGCCCACCGCCACGAGCCTCCT
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GTTCCTCACGACAAGGTGGTGGTAGATGAAGGCCAAGACCGAGAGGTGCCAGAAGAGAAC
XM_005257019.1      GTTCCTCACGACAAGGTGGTGGTAGATGAAGGCCAAGACCGAGAGGTGCCAGAAGAGAAC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AAACCTCCATCCAGACACGCGGGCGGAAAGGCTCCAGGGGTCCAGGGCCAGATGGCGCCG
XM_005257019.1      AAACCTCCATCCAGACACGCGGGCGGAAAGGCTCCAGGGGTCCAGGGCCAGATGGCGCCG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CCTCTGCCCGACTCAGAAAGAGAGAAACAAGAGCCGGAGCAGGGAGAGGTTGGGAAGAGG
XM_005257019.1      CCTCTGCCCGACTCAGAAAGAGAGAAACAAGAGCCGGAGCAGGGAGAGGTTGGGAAGAGG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CCTGGACAGGCCCAGGCCTTGGAGGAGGCGGGTGATCTTCCTGAAGATCCCCAGAAAGTT
XM_005257019.1      CCTGGACAGGCCCAGGCCTTGGAGGAGGCGGGTGATCTTCCTGAAGATCCCCAGAAAGTT
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CCAGAAGCAGATGGTCAGCCAGCTGTCCAGCCTGCAAAGGAGGACCTGGGGCCAGGAGAC
XM_005257019.1      CCAGAAGCAGATGGTCAGCCAGCTGTCCAGCCTGCAAAGGAGGACCTGGGGCCAGGAGAC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AGGGGCCTGCATCCTCGGCCCCAGGCAGTGCTGTCTGAGCAGCAGAACGGCCTGGCGGTG
XM_005257019.1      AGGGGCCTGCATCCTCGGCCCCAGGCAGTGCTGTCTGAGCAGCAGAACGGCCTGGCGGTG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GGTGGAGGGGAAAAGGCCAAGGGGGGACCGCCGCCAGGCAACGCCGCCGGGGACACAGGG
XM_005257019.1      GGTGGAGGGGAAAAGGCCAAGGGGGGACCGCCGCCAGGCAACGCCGCCGGGGACACAGGG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CAGCCCGCAGAGGACAGCGACCACGGTGGGAAGCCTCCCCTCCCAGCGGAGAAGCCGGCT
XM_005257019.1      CAGCCCGCAGAGGACAGCGACCACGGTGGGAAGCCTCCCCTCCCAGCGGAGAAGCCGGCT
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CCAGGGCCTGGGCTGCCGCCCGAGCCTCGCGAGCAGAGGGACGTGGAGCGAGCGGGTGGA
XM_005257019.1      CCAGGGCCTGGGCTGCCGCCCGAGCCTCGCGAGCAGAGGGACGTGGAGCGAGCGGGTGGA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AACCAGGCGGCCAGCCAGCTGGAG------------------------GAAGCTGGCAGG
XM_005257019.1      AACCAGGCGGCCAGCCAGCTGGAGGCTGAAATTAAAAAGATAGTAGCAGAAGCTGGCAGG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GCGGAGATGCTGGACCACGCCGTCCTGCTTCAGGTGATCAAAGAACAGCAGGTGCAGCAA
XM_005257019.1      GCGGAGATGCTGGACCACGCCGTCCTGCTTCAGGTGATCAAAGAACAGCAGGTGCAGCAA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AAGCGCTTGCTGGACCAGCAGGAGAAGCTGCTGGCGGTGATCGAGGAGCAGCACAAGGAG
XM_005257019.1      AAGCGCTTGCTGGACCAGCAGGAGAAGCTGCTGGCGGTGATCGAGGAGCAGCACAAGGAG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      ATCCACCAGCAGAGGCAGGAGGACGAGGAGGATAAACCCAGGCAGGTGGAGGTGCATCAA
XM_005257019.1      ATCCACCAGCAGAGGCAGGAGGACGAGGAGGATAAACCCAGGCAGGTGGAGGTGCATCAA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GAGCCCGGGGCAGCGGTGCCCAGAGGCCAGGAGGCCCCTGAAGGCAAGGCCAGGGAGACG
XM_005257019.1      GAGCCCGGGGCAGCGGTGCCCAGAGGCCAGGAGGCCCCTGAAGGCAAGGCCAGGGAGACG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GTGGAGAATCTGCCTCCCCTGCCTTTGGACCCTGTCCTCAGAGCTCCTGGGGGCCGCCCT
XM_005257019.1      GTGGAGAATCTGCCTCCCCTGCCTTTGGACCCTGTCCTCAGAGCTCCTGGGGGCCGCCCT
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GCTCCATCCCAGGACCTTAACCAGCGCTCCCTGGAGCACTCTGAGGGGCCTGTGGGCAGA
XM_005257019.1      GCTCCATCCCAGGACCTTAACCAGCGCTCCCTGGAGCACTCTGAGGGGCCTGTGGGCAGA
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      GACCCTGCTGGCCCTCCTGACGGCGGCCCTGACACAGAGCCTCGGGCAGCCCAGGCCAAG
XM_005257019.1      GACCCTGCTGGCCCTCCTGACGGCGGCCCTGACACAGAGCCTCGGGCAGCCCAGGCCAAG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CTGAGAGATGGCCAGAAGGATGCCGCCCCCAGGGCAGCTGGCACTGTGAAGGAGCTCCCC
XM_005257019.1      CTGAGAGATGGCCAGAAGGATGCCGCCCCCAGGGCAGCTGGCACTGTGAAGGAGCTCCCC
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AAGGGCCCGGAGCAGGTGCCCGTGCCAGACCCCGCCAGGGAAGCCGGGGGCCCAGAGGAG
XM_005257019.1      AAGGGCCCGGAGCAGGTGCCCGTGCCAGACCCCGCCAGGGAAGCCGGGGGCCCAGAGGAG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      CGCCTCGCAGAGGAATTCCCTGGGCAAAGTCAGGACGTTACTGGCGGTTCCCAAGACAGG
XM_005257019.1      CGCCTCGCAGAGGAATTCCCTGGGCAAAGTCAGGACGTTACTGGCGGTTCCCAAGACAGG
                                                                                

HsCD00000205        ------------------------------------------------------------
NM_001037984.2      AAAAAACCTGGGAAGGAGGTGGCAGCCACTGGCACCAGCATTCTGAAGGAAGCCAACTGG
XM_005257019.1      AAAAAACCTGGGAAGGAGGTGGCAGCCACTGGCACCAGCATTCTGAAGGAAGCCAACTGG
                                                                                

HsCD00000205        ---------------------------------------ATGAAGCCCAAGCAAGTGAGC
NM_001037984.2      CTCGTGGCAGGGCCAGGAGCAGAGACGGGGGACCCTCGCATGAAGCCCAAGCAAGTGAGC
XM_005257019.1      CTCGTGGCAGGGCCAGGAGCAGAGACGGGGGACCCTCGCATGAAGCCCAAGCAAGTGAGC
                                                           *********************

HsCD00000205        CGAGACCTGGGCCTTGCAGCGGACCTGCCCGGTGGGGCGGAAGGAGCAGCTGCACAGCCC
NM_001037984.2      CGAGACCTGGGCCTTGCAGCGGACCTGCCCGGTGGGGCGGAAGGAGCAGCTGCACAGCCC
XM_005257019.1      CGAGACCTGGGCCTTGCAGCGGACCTGCCCGGTGGGGCGGAAGGAGCAGCTGCACAGCCC
                    ************************************************************

HsCD00000205        CAGGCTGTGTTACGCCAGCCGGAACTGCGGGTCATCTCTGATGGCGAGCAGGGTGGACAG
NM_001037984.2      CAGGCTGTGTTACGCCAGCCGGAACTGCGGGTCATCTCTGATGGCGAGCAGGGTGGACAG
XM_005257019.1      CAGGCTGTGTTACGCCAGCCGGAACTGCGGGTCATCTCTGATGGCGAGCAGGGTGGACAG
                    ************************************************************

HsCD00000205        CAGGGCCACCGGCTGGACCATGGCGGTCACCTGGAGATGAGAAAGGCCCGCGGGGGGGAC
NM_001037984.2      CAGGGCCACCGGCTGGACCATGGCGGTCACCTGGAGATGAGAAAGGCCCGCGGGGGGGAC
XM_005257019.1      CAGGGCCACCGGCTGGACCATGGCGGTCACCTGGAGATGAGAAAGGCCCGCGGGGGGGAC
                    ************************************************************

HsCD00000205        CATGTGCCTGTGTCCCACGAGCAGCCGAGAGGCGGGGAGGACGCTGCTGTCCAGGAGCCC
NM_001037984.2      CATGTGCCTGTGTCCCACGAGCAGCCGAGAGGCGGGGAGGACGCTGCTGTCCAGGAGCCC
XM_005257019.1      CATGTGCCTGTGTCCCACGAGCAGCCGAGAGGCGGGGAGGACGCTGCTGTCCAGGAGCCC
                    ************************************************************

HsCD00000205        AGGCAGAGGCCAGAGCCAGAGCTGGGGCTCAAACGAGCTGTCCCGGGGGGCCAGAGGCCG
NM_001037984.2      AGGCAGAGGCCAGAGCCAGAGCTGGGGCTCAAACGAGCTGTCCCGGGGGGCCAGAGGCCG
XM_005257019.1      AGGCAGAGGCCAGAGCCAGAGCTGGGGCTCAAACGAGCTGTCCCGGGGGGCCAGAGGCCG
                    ************************************************************

HsCD00000205        GACAATGCCAAGCCCAACCGGGACCTGAAACTGCAGGCTGGCTCCGACCTCCGGAGGCGA
NM_001037984.2      GACAATGCCAAGCCCAACCGGGACCTGAAACTGCAGGCTGGCTCCGACCTCCGGAGGCGA
XM_005257019.1      GACAATGCCAAGCCCAACCGGGACCTGAAACTGCAGGCTGGCTCCGACCTCCGGAGGCGA
                    ************************************************************

HsCD00000205        CGGCGGGACCTTGGCCCTCATGCAGAGGGTCAGCTGGCCCCGAGGGATGGG---GTCATT
NM_001037984.2      CGGCGGGACCTTGGCCCTCATGCAGAGGGTCAGCTGGCCCCGAGGGATGGGGTCATCATT
XM_005257019.1      CGGCGGGACCTTGGCCCTCATGCAGAGGGTCAGCTGGCCCCGAGGGATGGGGTCATCATT
                    ***************************************************   .*****

HsCD00000205        GGCCTTAACCCCCTGCCTGATGTCCAGGTGAACGACCTCCGTGGCGCCCTGGATGCCCAG
NM_001037984.2      GGCCTTAACCCCCTGCCTGATGTCCAGGTGAACGACCTCCGTGGCGCCCTGGATGCCCAG
XM_005257019.1      GGCCTTAACCCCCTGCCTGATGTCCAGGTGAACGACCTCCGTGGCGCCCTGGATGCCCAG
                    ************************************************************

HsCD00000205        CTCCGCCAGGCTGCGGGGGGAGCTCTGCAGGTGGTCCACAGCCGGCAGCTTAGACAGGCG
NM_001037984.2      CTCCGCCAGGCTGCGGGGGGAGCTCTGCAGGTGGTCCACAGCCGGCAGCTTAGACAGGCG
XM_005257019.1      CTCCGCCAGGCTGCGGGGGGAGCTCTGCAGGTGGTCCACAGCCGGCAGCTTAGACAGGCG
                    ************************************************************

HsCD00000205        CCTGGGCCTCCAGAGGAGTCCTTG
NM_001037984.2      CCTGGGCCTCCAGAGGAGTCCTAG
XM_005257019.1      CCTGGGCCTCCAGAGGAGTCCTAG
                    **********************:*

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : Arf6 trafficking events
NCI : Beta1 integrin cell surface interactions
NCI : CXCR4-mediated signaling events
NCI : Integrin family cell surface interactions
NCI : Plexin-D1 Signaling
NCI : Reelin signaling pathway
NCI : RhoA signaling pathway
NCI : Signaling events mediated by PRL
NCI : Signaling events mediated by TCPTP
NCI : Signaling events mediated by focal adhesion kinase
NCI : Syndecan-2-mediated signaling events
NCI : Syndecan-4-mediated signaling events
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : VEGFR3 signaling in lymphatic endothelium
NCI : Validated targets of C-MYC transcriptional repression
NCI : a4b7 Integrin signaling
NCI : a6b1 and a6b4 Integrin signaling
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Integrin signalling pathway
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Basigin interactions
Reactome : CHL1 interactions
Reactome : Cell junction organization
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Cell-extracellular matrix interactions
Reactome : Developmental Biology
Reactome : ECM proteoglycans
Reactome : Elastic fibre formation
Reactome : Extracellular matrix organization
Reactome : Fibronectin matrix formation
Reactome : Hemostasis
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Integrin cell surface interactions
Reactome : L1CAM interactions
Reactome : Laminin interactions
Reactome : Localization of the PINCH-ILK-PARVIN complex to focal adhesions
Reactome : Molecules associated with elastic fibres
Reactome : Non-integrin membrane-ECM interactions
Reactome : Other semaphorin interactions
Reactome : Platelet Adhesion to exposed collagen
Reactome : Semaphorin interactions
Reactome : Signal transduction by L1
Reactome : Syndecan interactions
WikiPathway : Focal Adhesion
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Neural Crest Differentiation
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TGF beta Signaling Pathway

Protein

UniProt : P05556
HPRD : 17506

Clone

Cloning Information : 117891
HIP Master Clone ID : 93737
Original Clone ID : FLH117891.01L

Organism


TAX_ID : 9606
Species Specific ID: 3688

Genome

Chromosome : 17
Map Location : 17q25.3
Ensembl : ENSG00000157637

Reagents

Labome : beta1-integrin-antibody