DNASU Plasmid Repository • 480.965.5697 | Email

EIF3S2 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  EIF3I
Gene Name:  eukaryotic translation initiation factor 3, subunit I
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH055993.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / Yes
Publications: None
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 978nts         Open reading frame : 1 to 978
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 995
Start on reference sequence 18

5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : EIF3I
Symbol Nomenclature : EIF3I
SYNONYM : EIF3S2; PRO2242; TRIP-1; TRIP1; eIF3-beta; eIF3-p36
Designation : TGF-beta receptor-interacting protein 1|TGFbeta receptor-interacting protein 1|eIF-3-beta|eIF3 p36|eukaryotic translation initiation factor 3 subunit 2|eukaryotic translation initiation factor 3 subunit I|eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD)|eukaryotic translation initiation factor 3, subunit 2 beta, 36kDa|predicted protein of HQ2242
Full Nomenclature : eukaryotic translation initiation factor 3, subunit I
GENEID : 8668
Locus Tag : RP4-675E8.1
GI : 60813639
GenBank Accession : AY893232
HGNC : 3272
MIM : 603911
Vega : OTTHUMG00000007364
Target GenBank: NM_003757


Reference Sequence Alignment



                  ************************ ***********************************














                  ******************************************************** ***



Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Cap-dependent Translation Initiation
Reactome : Eukaryotic Translation Initiation
Reactome : Formation of a pool of free 40S subunits
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of proteins
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
WikiPathway : Translation Factors


SMART domain : WD40 : WD40 repeats
UniProt : Q13347
UniProt : Q5U0F4
HPRD : 04884


Cloning Information : 55993
HIP Master Clone ID : 33857
Original Clone ID : FLH055993.01X


TAX_ID : 9606
Species Specific ID: 8668


Chromosome : 1
Map Location : 1p34.1
Ensembl : ENSG00000084623


Labome : EIF3I-antibody