DNASU Plasmid Repository • 480.965.5697 | Email

EIF3S3 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  EIF3H
Gene Name:  eukaryotic translation initiation factor 3, subunit H
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH056037.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000211

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1059nts         Open reading frame : 1 to 1059
Reference Sequence Alignment

ATGGCGTCCCGCAAGGAAGGTACCGGCTCTACTGCCACCTCTTCCAGCTCCACCGCCGGC
GCAGCAGGGAAAGGCAAAGGCAAAGGCGGCTCGGGAGATTCAGCCGTGAAGCAAGTGCAG
ATAGATGGCCTTGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACT
GAAGTTGTTCAAGGAGTGCTTTTGGGTCTGGTTGTAGAAGATCGGCTTGAAATTACCAAC
TGCTTTCCTTTCCCTCAGCACACAGAGGATGATGCTGACTTTGATGAAGTCCAATATCAG
ATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGATCATCTTCACGTGGGCTGGTAT
CAGTCCACATACTATGGCTCATTCGTTACCCGGGCACTCCTGGACTCTCAGTTTAGTTAC
CAGCATGCCATTGAAGAATCTGTCGTTCTCATTTATGATCCCATAAAAACTGCCCAAGGA
TCTCTCTCACTAAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAAAAG
GATTTTTCCCCTGAAGCATTGAAAAAAGCAAATATCACCTTTGAGTACATGTTTGAAGAA
GTGCCGATTGTAATTAAAAATTCACATCTGATCAATGTCCTAATGTGGGAACTTGAAAAG
AAGTCAGCTGTTGCAGATAAACATGAATTGCTCAGCCTTGCCAGCAGCAATCATTTGGGG
AAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATAC
AACACATACATGAGGAATACTAGTAAACAACAGCAGCAGAAACATCAGTATCAGCAGCGT
CGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGAGAACCCCCGCTCCCTGAGGAGGAC
CTGTCCAAACTCTTCAAACCACCACAGCCGCCTGCCAGGATGGACTCGCTGCTCATTGCA
GGCCAGATAAACACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAG
CTCTTCATGGCCCAGGCTCTTCAAGAATACAACAACTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1064
Start on reference sequence 6
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : EIF3H
Symbol Nomenclature : EIF3H
SYNONYM : EIF3S3; eIF3-gamma; eIF3-p40
Designation : eIF-3-gamma|eIF3 p40 subunit|eukaryotic translation initiation factor 3 subunit 3|eukaryotic translation initiation factor 3 subunit H|eukaryotic translation initiation factor 3, subunit 2 (beta, 36kD)|eukaryotic translation initiation factor 3, subunit 3 (gamma, 40kD)|eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa
Full Nomenclature : eukaryotic translation initiation factor 3, subunit H
GENEID : 8667
GI : 60813659
GenBank Accession : AY893233
HGNC : 3273
MIM : 603912
Target GenBank: NM_003756

 

Reference Sequence Alignment

  

HsCD00000211      ATGGCGTCCCGCAAGGAAGGTACCGGCTCTACTGCCACCTCTTCCAGCTCCACCGCCGGC
NM_003756.2       ATGGCGTCCCGCAAGGAAGGTACCGGCTCTACTGCCACCTCTTCCAGCTCCACCGCCGGC
                  ************************************************************

HsCD00000211      GCAGCAGGGAAAGGCAAAGGCAAAGGCGGCTCGGGAGATTCAGCCGTGAAGCAAGTGCAG
NM_003756.2       GCAGCAGGGAAAGGCAAAGGCAAAGGCGGCTCGGGAGATTCAGCCGTGAAGCAAGTGCAG
                  ************************************************************

HsCD00000211      ATAGATGGCCTTGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACT
NM_003756.2       ATAGATGGCCTTGTGGTATTAAAGATAATCAAACATTATCAAGAAGAAGGACAAGGAACT
                  ************************************************************

HsCD00000211      GAAGTTGTTCAAGGAGTGCTTTTGGGTCTGGTTGTAGAAGATCGGCTTGAAATTACCAAC
NM_003756.2       GAAGTTGTTCAAGGAGTGCTTTTGGGTCTGGTTGTAGAAGATCGGCTTGAAATTACCAAC
                  ************************************************************

HsCD00000211      TGCTTTCCTTTCCCTCAGCACACAGAGGATGATGCTGACTTTGATGAAGTCCAATATCAG
NM_003756.2       TGCTTTCCTTTCCCTCAGCACACAGAGGATGATGCTGACTTTGATGAAGTCCAATATCAG
                  ************************************************************

HsCD00000211      ATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGATCATCTTCACGTGGGCTGGTAT
NM_003756.2       ATGGAAATGATGCGGAGCCTTCGCCATGTAAACATTGATCATCTTCACGTGGGCTGGTAT
                  ************************************************************

HsCD00000211      CAGTCCACATACTATGGCTCATTCGTTACCCGGGCACTCCTGGACTCTCAGTTTAGTTAC
NM_003756.2       CAGTCCACATACTATGGCTCATTCGTTACCCGGGCACTCCTGGACTCTCAGTTTAGTTAC
                  ************************************************************

HsCD00000211      CAGCATGCCATTGAAGAATCTGTCGTTCTCATTTATGATCCCATAAAAACTGCCCAAGGA
NM_003756.2       CAGCATGCCATTGAAGAATCTGTCGTTCTCATTTATGATCCCATAAAAACTGCCCAAGGA
                  ************************************************************

HsCD00000211      TCTCTCTCACTAAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAAAAG
NM_003756.2       TCTCTCTCACTAAAGGCATACAGACTGACTCCTAAACTGATGGAAGTTTGTAAAGAAAAG
                  ************************************************************

HsCD00000211      GATTTTTCCCCTGAAGCATTGAAAAAAGCAAATATCACCTTTGAGTACATGTTTGAAGAA
NM_003756.2       GATTTTTCCCCTGAAGCATTGAAAAAAGCAAATATCACCTTTGAGTACATGTTTGAAGAA
                  ************************************************************

HsCD00000211      GTGCCGATTGTAATTAAAAATTCACATCTGATCAATGTCCTAATGTGGGAACTTGAAAAG
NM_003756.2       GTGCCGATTGTAATTAAAAATTCACATCTGATCAATGTCCTAATGTGGGAACTTGAAAAG
                  ************************************************************

HsCD00000211      AAGTCAGCTGTTGCAGATAAACATGAATTGCTCAGCCTTGCCAGCAGCAATCATTTGGGG
NM_003756.2       AAGTCAGCTGTTGCAGATAAACATGAATTGCTCAGCCTTGCCAGCAGCAATCATTTGGGG
                  ************************************************************

HsCD00000211      AAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATAC
NM_003756.2       AAGAATCTACAGTTGCTGATGGACAGAGTGGATGAAATGAGCCAAGATATAGTTAAATAC
                  ************************************************************

HsCD00000211      AACACATACATGAGGAATACTAGTAAACAACAGCAGCAGAAACATCAGTATCAGCAGCGT
NM_003756.2       AACACATACATGAGGAATACTAGTAAACAACAGCAGCAGAAACATCAGTATCAGCAGCGT
                  ************************************************************

HsCD00000211      CGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGAGAACCCCCGCTCCCTGAGGAGGAC
NM_003756.2       CGCCAGCAGGAGAATATGCAGCGCCAGAGCCGAGGAGAACCCCCGCTCCCTGAGGAGGAC
                  ************************************************************

HsCD00000211      CTGTCCAAACTCTTCAAACCACCACAGCCGCCTGCCAGGATGGACTCGCTGCTCATTGCA
NM_003756.2       CTGTCCAAACTCTTCAAACCACCACAGCCGCCTGCCAGGATGGACTCGCTGCTCATTGCA
                  ************************************************************

HsCD00000211      GGCCAGATAAACACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAG
NM_003756.2       GGCCAGATAAACACTTACTGCCAGAACATCAAGGAGTTCACTGCCCAAAACTTAGGCAAG
                  ************************************************************

HsCD00000211      CTCTTCATGGCCCAGGCTCTTCAAGAATACAACAACTAG
NM_003756.2       CTCTTCATGGCCCAGGCTCTTCAAGAATACAACAACTAA
                  **************************************.

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : Activation of the mRNA upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S
Reactome : Cap-dependent Translation Initiation
Reactome : Eukaryotic Translation Initiation
Reactome : Formation of a pool of free 40S subunits
Reactome : Formation of the ternary complex, and subsequently, the 43S complex
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of proteins
Reactome : Ribosomal scanning and start codon recognition
Reactome : Translation
Reactome : Translation initiation complex formation
WikiPathway : Translation Factors

Protein

SMART domain : JAB_MPN : JAB/MPN domain
UniProt : Q6IB98
UniProt : O15372
HPRD : 04885

Clone

Cloning Information : 56037
HIP Master Clone ID : 33901
Original Clone ID : FLH056037.01X

Organism


TAX_ID : 9606
Species Specific ID: 8667

Genome

Chromosome : 8
Map Location : 8q24.11

Reagents

Labome : EIF3H-antibody