DNASU Plasmid Repository • 480.965.5697 | Email

BLK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  BLK
Gene Name:  B lymphoid tyrosine kinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH172261.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00021334

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1518nts         Open reading frame : 1 to 1518
Reference Sequence Alignment

ATGGGGCTGGTAAGTAGCAAAAAGCCGGACAAGGAAAAGCCGATCAAAGAGAAGGACAAG
GGCCAATGGAGCCCCCTGAAGGTCAGCGCCCAAGACAAGGACGCCCCGCCACTGCCGCCC
CTGGTTGTCTTCAACCACCTTACTCCTCCACCGCCCGATGAACACCTGGATGAAGACAAG
CATTTCGTGGTGGCTCTGTATGACTACACCGCTATGAATGATCGGGACCTGCAGATGCTG
AAGGGGGAGAAGCTACAGGTCCTGAAGGGAACTGGAGACTGGTGGCTGGCCAGGTCACTC
GTCACAGGAAGAGAAGGCTATGTGCCCAGTAACTTTGTGGCCCGAGTGGAGAGCCTGGAA
ATGGAAAGGTGGTTCTTTAGATCACAGGGTCGGAAGGAGGCTGAGAGGCAGCTTCTTGCT
CCAATCAACAAGGCCGGCTCCTTTCTTATCAGAGAGAGTGAAACCAACAAAGGTGCCTTC
TCCCTGTCTGTGAAGGATGTCACCACCCAGGGGGAGCTGATCAAGCACTATAAGATCCGC
TGCCTGGATGAAGGGGGCTACTACATCTCCCCCCGGATCACCTTCCCCTCGCTCCAGGCC
CTGGTGCAGCACTATTCTAAGAAGGGGGATGGTCTATGCCAGAGGCTGACCCTGCCCTGT
GTGCGCCCGGCCCCGCAGAATCCCTGGGCCCAGGATGAATGGGAGATCCCCCGGCAGTCT
CTCAGGCTGGTCAGGAAACTCGGGTCTGGACAATTCGGCGAAGTCTGGATGGGTTACTAC
AAAAACAACATGAAGGTGGCCATTAAGACGCTGAAGGAGGGAACCATGTCTCCAGAAGCC
TTCCTGGGTGAGGCCAACGTGATGAAGGCTCTGCAGCACGAGCGGCTGGTCCGACTCTAC
GCAGTGGTCACCAAGGAGCCCATCTACATTGTCACCGAGTACATGGCCAGAGGATGCCTG
CTGGATTTCCTGAAGACAGATGAAGGGAGCAGATTGTCACTCCCAAGGCTGATTGACATG
TCGGCGCAGATTGCTGAAGGGATGGCATACATTGAGCGCATGAATTCCATCCACCGCGAC
CTGCGGGCGGCCAACATCCTGGTGTCTGAGGCCTTGTGCTGCAAAATTGCTGATTTTGGC
TTGGCTCGAATCATCGACAGTGAATACACGGCCCAAGAGGGGGCCAAGTTCCCCATCAAG
TGGACAGCCCCGGAAGCCATCCACTTCGGGGTCTTCACCATCAAAGCAGACGTGTGGTCG
TTTGGAGTCCTCCTGATGGAAGTTGTCACTTATGGGCGGGTGCCATACCCAGGGATGAGC
AACCCCGAGGTCATCCGCAACCTGGAGCGCGGCTACCGCATGCCGCGCCCCGACACCTGC
CCGCCCGAGCTGTACCGCGGCGTCATCGCCGAGTGCTGGCGCAGCCGGCCCGAGGAGCGG
CCCACCTTCGAGTTCCTGCAGTCGGTGCTGGAGGACTTCTACACGGCCACCGAGCGGCAG
TACGAGCTGCAGCCCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1740
Start on reference sequence 223
Mutations:
None
Discrepancy:
c330t; a859g,M287V
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : BLK
Symbol Nomenclature : BLK
SYNONYM : MODY11
Designation : BLK nonreceptor tyrosine kinase|b lymphocyte kinase|p55-Blk|tyrosine-protein kinase Blk
Full Nomenclature : B lymphoid tyrosine kinase
GENEID : 640
HGNC : 1057
MIM : 191305
Vega : OTTHUMG00000090729
Target GenBank: NM_001715

 

Reference Sequence Alignment

  

HsCD00021334      ATGGGGCTGGTAAGTAGCAAAAAGCCGGACAAGGAAAAGCCGATCAAAGAGAAGGACAAG
NM_001715.2       ATGGGGCTGGTAAGTAGCAAAAAGCCGGACAAGGAAAAGCCGATCAAAGAGAAGGACAAG
                  ************************************************************

HsCD00021334      GGCCAATGGAGCCCCCTGAAGGTCAGCGCCCAAGACAAGGACGCCCCGCCACTGCCGCCC
NM_001715.2       GGCCAATGGAGCCCCCTGAAGGTCAGCGCCCAAGACAAGGACGCCCCGCCACTGCCGCCC
                  ************************************************************

HsCD00021334      CTGGTTGTCTTCAACCACCTTACTCCTCCACCGCCCGATGAACACCTGGATGAAGACAAG
NM_001715.2       CTGGTTGTCTTCAACCACCTTACTCCTCCACCGCCCGATGAACACCTGGATGAAGACAAG
                  ************************************************************

HsCD00021334      CATTTCGTGGTGGCTCTGTATGACTACACCGCTATGAATGATCGGGACCTGCAGATGCTG
NM_001715.2       CATTTCGTGGTGGCTCTGTATGACTACACCGCTATGAATGATCGGGACCTGCAGATGCTG
                  ************************************************************

HsCD00021334      AAGGGGGAGAAGCTACAGGTCCTGAAGGGAACTGGAGACTGGTGGCTGGCCAGGTCACTC
NM_001715.2       AAGGGGGAGAAGCTACAGGTCCTGAAGGGAACTGGAGACTGGTGGCTGGCCAGGTCACTC
                  ************************************************************

HsCD00021334      GTCACAGGAAGAGAAGGCTATGTGCCCAGTAACTTTGTGGCCCGAGTGGAGAGCCTGGAA
NM_001715.2       GTCACAGGAAGAGAAGGCTATGTGCCCAGTAACTTTGTGGCCCGAGTGGAGAGCCTGGAA
                  ************************************************************

HsCD00021334      ATGGAAAGGTGGTTCTTTAGATCACAGGGTCGGAAGGAGGCTGAGAGGCAGCTTCTTGCT
NM_001715.2       ATGGAAAGGTGGTTCTTTAGATCACAGGGTCGGAAGGAGGCTGAGAGGCAGCTTCTTGCT
                  ************************************************************

HsCD00021334      CCAATCAACAAGGCCGGCTCCTTTCTTATCAGAGAGAGTGAAACCAACAAAGGTGCCTTC
NM_001715.2       CCAATCAACAAGGCCGGCTCCTTTCTTATCAGAGAGAGTGAAACCAACAAAGGTGCCTTC
                  ************************************************************

HsCD00021334      TCCCTGTCTGTGAAGGATGTCACCACCCAGGGGGAGCTGATCAAGCACTATAAGATCCGC
NM_001715.2       TCCCTGTCTGTGAAGGATGTCACCACCCAGGGGGAGCTGATCAAGCACTATAAGATCCGC
                  ************************************************************

HsCD00021334      TGCCTGGATGAAGGGGGCTACTACATCTCCCCCCGGATCACCTTCCCCTCGCTCCAGGCC
NM_001715.2       TGCCTGGATGAAGGGGGCTACTACATCTCCCCCCGGATCACCTTCCCCTCGCTCCAGGCC
                  ************************************************************

HsCD00021334      CTGGTGCAGCACTATTCTAAGAAGGGGGATGGTCTATGCCAGAGGCTGACCCTGCCCTGT
NM_001715.2       CTGGTGCAGCACTATTCTAAGAAGGGGGATGGTCTATGCCAGAGGCTGACCCTGCCCTGT
                  ************************************************************

HsCD00021334      GTGCGCCCGGCCCCGCAGAATCCCTGGGCCCAGGATGAATGGGAGATCCCCCGGCAGTCT
NM_001715.2       GTGCGCCCGGCCCCGCAGAATCCCTGGGCCCAGGATGAATGGGAGATCCCCCGGCAGTCT
                  ************************************************************

HsCD00021334      CTCAGGCTGGTCAGGAAACTCGGGTCTGGACAATTCGGCGAAGTCTGGATGGGTTACTAC
NM_001715.2       CTCAGGCTGGTCAGGAAACTCGGGTCTGGACAATTCGGCGAAGTCTGGATGGGTTACTAC
                  ************************************************************

HsCD00021334      AAAAACAACATGAAGGTGGCCATTAAGACGCTGAAGGAGGGAACCATGTCTCCAGAAGCC
NM_001715.2       AAAAACAACATGAAGGTGGCCATTAAGACGCTGAAGGAGGGAACCATGTCTCCAGAAGCC
                  ************************************************************

HsCD00021334      TTCCTGGGTGAGGCCAACGTGATGAAGGCTCTGCAGCACGAGCGGCTGGTCCGACTCTAC
NM_001715.2       TTTCTGGGTGAGGCCAACGTGATGAAGGCTCTGCAGCACGAGCGGCTGGTCCGACTCTAC
                  ** *********************************************************

HsCD00021334      GCAGTGGTCACCAAGGAGCCCATCTACATTGTCACCGAGTACATGGCCAGAGGATGCCTG
NM_001715.2       GCAGTGGTCACCAAGGAGCCCATCTACATTGTCACCGAGTACATGGCCAGAGGATGCCTG
                  ************************************************************

HsCD00021334      CTGGATTTCCTGAAGACAGATGAAGGGAGCAGATTGTCACTCCCAAGGCTGATTGACATG
NM_001715.2       CTGGATTTCCTGAAGACAGATGAAGGGAGCAGATTGTCACTCCCAAGGCTGATTGACATG
                  ************************************************************

HsCD00021334      TCGGCGCAGATTGCTGAAGGGATGGCATACATTGAGCGCATGAATTCCATCCACCGCGAC
NM_001715.2       TCGGCGCAGATTGCTGAAGGGATGGCATACATTGAGCGCATGAATTCCATCCACCGCGAC
                  ************************************************************

HsCD00021334      CTGCGGGCGGCCAACATCCTGGTGTCTGAGGCCTTGTGCTGCAAAATTGCTGATTTTGGC
NM_001715.2       CTGCGGGCGGCCAACATCCTGGTGTCTGAGGCCTTGTGCTGCAAAATTGCTGATTTTGGC
                  ************************************************************

HsCD00021334      TTGGCTCGAATCATCGACAGTGAATACACGGCCCAAGAGGGGGCCAAGTTCCCCATCAAG
NM_001715.2       TTGGCTCGAATCATCGACAGTGAATACACGGCCCAAGAGGGGGCCAAGTTCCCCATCAAG
                  ************************************************************

HsCD00021334      TGGACAGCCCCGGAAGCCATCCACTTCGGGGTCTTCACCATCAAAGCAGACGTGTGGTCG
NM_001715.2       TGGACAGCCCCGGAAGCCATCCACTTCGGGGTCTTCACCATCAAAGCAGACGTGTGGTCG
                  ************************************************************

HsCD00021334      TTTGGAGTCCTCCTGATGGAAGTTGTCACTTATGGGCGGGTGCCATACCCAGGGATGAGC
NM_001715.2       TTTGGAGTCCTCCTGATGGAAGTTGTCACTTATGGGCGGGTGCCATACCCAGGGATGAGC
                  ************************************************************

HsCD00021334      AACCCCGAGGTCATCCGCAACCTGGAGCGCGGCTACCGCATGCCGCGCCCCGACACCTGC
NM_001715.2       AACCCCGAGGTCATCCGCAACCTGGAGCGCGGCTACCGCATGCCGCGCCCCGACACCTGC
                  ************************************************************

HsCD00021334      CCGCCCGAGCTGTACCGCGGCGTCATCGCCGAGTGCTGGCGCAGCCGGCCCGAGGAGCGG
NM_001715.2       CCGCCCGAGCTGTACCGCGGCGTCATCGCCGAGTGCTGGCGCAGCCGGCCCGAGGAGCGG
                  ************************************************************

HsCD00021334      CCCACCTTCGAGTTCCTGCAGTCGGTGCTGGAGGACTTCTACACGGCCACCGAGCGGCAG
NM_001715.2       CCCACCTTCGAGTTCCTGCAGTCGGTGCTGGAGGACTTCTACACGGCCACCGAGCGGCAG
                  ************************************************************

HsCD00021334      TACGAGCTGCAGCCCTAG
NM_001715.2       TACGAGCTGCAGCCCTAG
                  ******************

Pathways

NCI : Alpha-synuclein signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : EPHA forward signaling
NCI : Ephrin B reverse signaling
NCI : Glypican 1 network
NCI : PDGFR-beta signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Parkinson disease
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Immune System
Reactome : Signaling by the B Cell Receptor (BCR)
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Focal Adhesion

Clone

Cloning Information : 172261
HIP Master Clone ID : 146458
Original Clone ID : FLH172261.01X

Organism


TAX_ID : 9606
Species Specific ID: 640

Genome

Chromosome : 8
Map Location : 8p23-p22
Ensembl : ENSG00000136573

Reagents

Labome : BLK-antibody