DNASU Plasmid Repository • 480.965.5697 | Email

RPS6KA2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPS6KA2
Gene Name:  ribosomal protein S6 kinase, 90kDa, polypeptide 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH172678.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00021404

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2202nts         Open reading frame : 1 to 2202
Reference Sequence Alignment

ATGGACCTGAGCATGAAGAAGTTCGCCGTGCGCAGGTTCTTCTCTGTGTACCTGCGCAGG
AAGTCGCGCTCCAAGAGCTCCAGCCTGAGCCGGCTCGAGGAAGAAGGTGTCGTGAAGGAG
ATAGACATCAGCCATCATGTGAAGGAGGGCTTTGAGAAGGCAGATCCTTCCCAGTTTGAG
CTGCTGAAGGTTTTAGGACAAGGATCCTATGGAAAGGTGTTCCTGGTGAGGAAGGTGAAG
GGGTCCGACGCTGGGCAGCTCTACGCCATGAAGGTCCTTAAGAAAGCCACCCTAAAAGTT
CGGGACCGAGTGAGATCGAAGATGGAGAGAGACATCTTGGCAGAAGTGAATCACCCCTTC
ATTGTGAAGCTTCATTATGCCTTTCAGACGGAAGGAAAGCTCTACCTGATCCTGGACTTC
CTGCGGGGAGGGGACCTCTTCACCCGGCTCTCCAAAGAGGTCATGTTCACGGAGGAGGAT
GTCAAGTTCTACCTGGCTGAGCTGGCCTTGGCTTTAGACCATCTCCACAGCCTGGGGATC
ATCTACAGAGATCTGAAGCCTGAGAACATCCTCCTGGATGAAGAGGGGCACATTAAGATC
ACAGATTTCGGCCTGAGTAAGGAGGCCATTGACCACGACAAGAGAGCGTACTCCTTCTGC
GGGACGATCGAGTACATGGCGCCCGAGGTGGTGAACCGGCGAGGACACACGCAGAGTGCC
GACTGGTGGTCCTTCGGCGTGCTCATGTTTGAGATGCTCACGGGGTCCCTGCCGTTCCAG
GGGAAGGACAGGAAGGAGACCATGGCTCTCATCCTCAAAGCCAAGCTGGGGATGCCGCAG
TTCCTCAGTGGGGAGGCACAGAGTTTGCTGCGAGCTCTCTTCAAACGGAACCCCTGCAAC
CGGCTGGGTGCTGGCATTGACGGAGTGGAGGAAATTAAGCGCCATCCCTTCTTTGTGACC
ATAGACTGGAACACGCTGTACCGGAAGGAGATCAAGCCACCGTTCAAACCAGCAGTGGGC
AGGCCTGAGGACACCTTCCACTTTGACCCCGAGTTCACAGCGCGGACGCCCACAGACTCT
CCTGGCGTCCCCCCGAGTGCAAACGCTCATCACCTGTTTAGAGGATTCAGCTTTGTGGCC
TCAAGCCTGATCCAGGAGCCCTCACAGCAAGATCTGCACAAAGTCCCAGTTCACCCAATC
GTGCAGCAGTTACACGGGAACAACATCCACTTCACCGATGGCTACGAGATCAAGGAGGAC
ATCGGGGTGGGCTCCTACTCAGTGTGCAAGCGATGTGTGCATAAAGCCACAGACACCGAG
TATGCCGTGAAGATCATTGATAAGAGCAAGAGAGACCCCTCGGAAGAGATTGAGATCCTC
CTGCGGTACGGCCAGCACCCGAACATCATCACCCTCAAGGATGTCTATGATGATGGCAAG
TTTGTGTACCTGGTAATGGAGCTGATGCGTGGTGGGGAGCTCCTGGACCGCATCCTCCGG
CAGAGATACTTCTCGAAGCGCGAAGCCAGTGACGTCCTGTGCACCATCACCAAGACCATG
GACTACCTCCATTCCCAGGGGGTTGTTCATCGAGACCTGAAGCCGAGTAACATCCTGTAC
AGGGATGAGTCGGGGAGCCCAGAATCCATCCGAGTCTGCGACTTCGGCTTTGCCAAGCAG
CTGCGCGCGGGGAACGGGCTGCTCATGACACCCTGCTACACGGCCAATTTCGTGGCCCCG
GAGGTCCTGAAGCGTCAAGGCTATGATGCGGCGTGTGACATCTGGAGTTTGGGGATCCTG
TTGTACACCATGCTGGCAGGATTTACCCCTTTTGCAAATGGGCCAGACGATACCCCTGAG
GAGATTCTGGCGCGGATCGGCAGTGGGAAGTATGCCCTTTCTGGGGGAAACTGGGACTCG
ATATCTGACGCAGCTAAAGACGTCGTGTCCAAGATGCTCCACGTGGACCCTCATCAGCGC
CTGACGGCGATGCAAGTGCTCAAACACCCGTGGGTGGTCAACAGAGAGTACCTGTCCCCA
AACCAGCTCAGCCGACAGGACGTGCACCTGGTGAAGGGCGCGATGGCCGCCACCTACTTT
GCTCTAAACAGAACACCTCAGGCCCCGCGGCTGGAGCCCGTGCTGTCGTCCAACCTGGCT
CAGCGCAGAGGCATGAAGAGACTCACGTCCACGCGGTTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2429
Start on reference sequence 228
Mutations:
None
Discrepancy:
g1516a,E506K
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPS6KA2
Symbol Nomenclature : RPS6KA2
SYNONYM : HU-2; MAPKAPK1C; RSK; RSK3; S6K-alpha; S6K-alpha2; p90-RSK3; pp90RSK3
Designation : 90 kDa ribosomal protein S6 kinase 2|MAP kinase-activated protein kinase 1c|MAPK-activated protein kinase 1c|MAPKAP kinase 1c|MAPKAPK-1c|RSK-3|S6K-alpha-2|p90-RSK 2|p90RSK2|ribosomal S6 kinase 3|ribosomal protein S6 kinase alpha 2|ribosomal protein S6 kinase alpha-2
Full Nomenclature : ribosomal protein S6 kinase, 90kDa, polypeptide 2
GENEID : 6196
Locus Tag : RP1-168L15.2
HGNC : 10431
MIM : 601685
Vega : OTTHUMG00000016007
Target GenBank: BC002363

 

Reference Sequence Alignment

  

HsCD00021404        ------------------------ATGGACCTGAGCATGAAGAAGTTCGCCGTGCGCAGG
NM_021135.4         ------------------------ATGGACCTGAGCATGAAGAAGTTCGCCGTGCGCAGG
NM_001006932.1      ATGCCAATCGCACAGTTGCTGGAACTATGGAAAAAGATCGAGGTGGAGCCTATGGAAATA
                                            .*. . .:.*. ** .**.:* :  * .** ..* .

HsCD00021404        TTCTTCTCTGTGTACCTGCGCAGGAAGTCGCGCTCCAAGAGCTCCAGCCTGAGCCGGCTC
NM_021135.4         TTCTTCTCTGTGTACCTGCGCAGGAAGTCGCGCTCCAAGAGCTCCAGCCTGAGCCGGCTC
NM_001006932.1      GAGACCACAGAGGAGGATCTCAACCTGGATGTGGAGCCCACCACAGAAGACACTGCAGAA
                     : : *:*:*:* *  : * **. .:* .     . .. * *:*.... : *    . :.

HsCD00021404        GAGGAAGAAGGTGTCGTGAAGGAGATAGACATCAGCCATCATGTGAAGGAGGGCTTTGAG
NM_021135.4         GAGGAAGAAGGCGTCGTGAAGGAGATAGACATCAGCCATCATGTGAAGGAGGGCTTTGAG
NM_001006932.1      GAAGAAGAAGGCGTCGTGAAGGAGATAGACATCAGCCATCATGTGAAGGAGGGCTTTGAG
                    **.******** ************************************************

HsCD00021404        AAGGCAGATCCTTCCCAGTTTGAGCTGCTGAAGGTTTTAGGACAAGGATCCTATGGAAAG
NM_021135.4         AAGGCAGATCCTTCCCAGTTTGAGCTGCTGAAGGTTTTAGGACAAGGATCCTATGGAAAG
NM_001006932.1      AAGGCAGATCCTTCCCAGTTTGAGCTGCTGAAGGTTTTAGGACAAGGATCCTATGGAAAG
                    ************************************************************

HsCD00021404        GTGTTCCTGGTGAGGAAGGTGAAGGGGTCCGACGCTGGGCAGCTCTACGCCATGAAGGTC
NM_021135.4         GTGTTCCTGGTGAGGAAGGTGAAGGGGTCCGACGCTGGGCAGCTCTACGCCATGAAGGTC
NM_001006932.1      GTGTTCCTGGTGAGGAAGGTGAAGGGGTCCGACGCTGGGCAGCTCTACGCCATGAAGGTC
                    ************************************************************

HsCD00021404        CTTAAGAAAGCCACCCTAAAAGTTCGGGACCGAGTGAGATCGAAGATGGAGAGAGACATC
NM_021135.4         CTTAAGAAAGCCACCCTAAAAGTTCGGGACCGAGTGAGATCGAAGATGGAGAGAGACATC
NM_001006932.1      CTTAAGAAAGCCACCCTAAAAGTTCGGGACCGAGTGAGATCGAAGATGGAGAGAGACATC
                    ************************************************************

HsCD00021404        TTGGCAGAAGTGAATCACCCCTTCATTGTGAAGCTTCATTATGCCTTTCAGACGGAAGGA
NM_021135.4         TTGGCAGAAGTGAATCACCCCTTCATTGTGAAGCTTCATTATGCCTTTCAGACGGAAGGA
NM_001006932.1      TTGGCAGAAGTGAATCACCCCTTCATTGTGAAGCTTCATTATGCCTTTCAGACGGAAGGA
                    ************************************************************

HsCD00021404        AAGCTCTACCTGATCCTGGACTTCCTGCGGGGAGGGGACCTCTTCACCCGGCTCTCCAAA
NM_021135.4         AAGCTCTACCTGATCCTGGACTTCCTGCGGGGAGGGGACCTCTTCACCCGGCTCTCCAAA
NM_001006932.1      AAGCTCTACCTGATCCTGGACTTCCTGCGGGGAGGGGACCTCTTCACCCGGCTCTCCAAA
                    ************************************************************

HsCD00021404        GAGGTCATGTTCACGGAGGAGGATGTCAAGTTCTACCTGGCTGAGCTGGCCTTGGCTTTA
NM_021135.4         GAGGTCATGTTCACGGAGGAGGATGTCAAGTTCTACCTGGCTGAGCTGGCCTTGGCTTTA
NM_001006932.1      GAGGTCATGTTCACGGAGGAGGATGTCAAGTTCTACCTGGCTGAGCTGGCCTTGGCTTTA
                    ************************************************************

HsCD00021404        GACCATCTCCACAGCCTGGGGATCATCTACAGAGATCTGAAGCCTGAGAACATCCTCCTG
NM_021135.4         GACCATCTCCACAGCCTGGGGATCATCTACAGAGATCTGAAGCCTGAGAACATCCTCCTG
NM_001006932.1      GACCATCTCCACAGCCTGGGGATCATCTACAGAGATCTGAAGCCTGAGAACATCCTCCTG
                    ************************************************************

HsCD00021404        GATGAAGAGGGGCACATTAAGATCACAGATTTCGGCCTGAGTAAGGAGGCCATTGACCAC
NM_021135.4         GATGAAGAGGGGCACATTAAGATCACAGATTTCGGCCTGAGTAAGGAGGCCATTGACCAC
NM_001006932.1      GATGAAGAGGGGCACATTAAGATCACAGATTTCGGCCTGAGTAAGGAGGCCATTGACCAC
                    ************************************************************

HsCD00021404        GACAAGAGAGCGTACTCCTTCTGCGGGACGATCGAGTACATGGCGCCCGAGGTGGTGAAC
NM_021135.4         GACAAGAGAGCGTACTCCTTCTGCGGGACGATCGAGTACATGGCGCCCGAGGTGGTGAAC
NM_001006932.1      GACAAGAGAGCGTACTCCTTCTGCGGGACGATCGAGTACATGGCGCCCGAGGTGGTGAAC
                    ************************************************************

HsCD00021404        CGGCGAGGACACACGCAGAGTGCCGACTGGTGGTCCTTCGGCGTGCTCATGTTTGAGATG
NM_021135.4         CGGCGAGGACACACGCAGAGTGCCGACTGGTGGTCCTTCGGCGTGCTCATGTTTGAGATG
NM_001006932.1      CGGCGAGGACACACGCAGAGTGCCGACTGGTGGTCCTTCGGCGTGCTCATGTTTGAGATG
                    ************************************************************

HsCD00021404        CTCACGGGGTCCCTGCCGTTCCAGGGGAAGGACAGGAAGGAGACCATGGCTCTCATCCTC
NM_021135.4         CTCACGGGGTCCCTGCCGTTCCAGGGGAAGGACAGGAAGGAGACCATGGCTCTCATCCTC
NM_001006932.1      CTCACGGGGTCCCTGCCGTTCCAGGGGAAGGACAGGAAGGAGACCATGGCTCTCATCCTC
                    ************************************************************

HsCD00021404        AAAGCCAAGCTGGGGATGCCGCAGTTCCTCAGTGGGGAGGCACAGAGTTTGCTGCGAGCT
NM_021135.4         AAAGCCAAGCTGGGGATGCCGCAGTTCCTCAGTGGGGAGGCACAGAGTTTGCTGCGAGCT
NM_001006932.1      AAAGCCAAGCTGGGGATGCCGCAGTTCCTCAGTGGGGAGGCACAGAGTTTGCTGCGAGCT
                    ************************************************************

HsCD00021404        CTCTTCAAACGGAACCCCTGCAACCGGCTGGGTGCTGGCATTGACGGAGTGGAGGAAATT
NM_021135.4         CTCTTCAAACGGAACCCCTGCAACCGGCTGGGTGCTGGCATTGACGGAGTGGAGGAAATT
NM_001006932.1      CTCTTCAAACGGAACCCCTGCAACCGGCTGGGTGCTGGCATTGACGGAGTGGAGGAAATT
                    ************************************************************

HsCD00021404        AAGCGCCATCCCTTCTTTGTGACCATAGACTGGAACACGCTGTACCGGAAGGAGATCAAG
NM_021135.4         AAGCGCCATCCCTTCTTTGTGACCATAGACTGGAACACGCTGTACCGGAAGGAGATCAAG
NM_001006932.1      AAGCGCCATCCCTTCTTTGTGACCATAGACTGGAACACGCTGTACCGGAAGGAGATCAAG
                    ************************************************************

HsCD00021404        CCACCGTTCAAACCAGCAGTGGGCAGGCCTGAGGACACCTTCCACTTTGACCCCGAGTTC
NM_021135.4         CCACCGTTCAAACCAGCAGTGGGCAGGCCTGAGGACACCTTCCACTTTGACCCCGAGTTC
NM_001006932.1      CCACCGTTCAAACCAGCAGTGGGCAGGCCTGAGGACACCTTCCACTTTGACCCCGAGTTC
                    ************************************************************

HsCD00021404        ACAGCGCGGACGCCCACAGACTCTCCTGGCGTCCCCCCGAGTGCAAACGCTCATCACCTG
NM_021135.4         ACAGCGCGGACGCCCACAGACTCTCCTGGCGTCCCCCCGAGTGCAAACGCTCATCACCTG
NM_001006932.1      ACAGCGCGGACGCCCACAGACTCTCCTGGCGTCCCCCCGAGTGCAAACGCTCATCACCTG
                    ************************************************************

HsCD00021404        TTTAGAGGATTCAGCTTTGTGGCCTCAAGCCTGATCCAGGAGCCCTCACAGCAAGATCTG
NM_021135.4         TTTAGAGGATTCAGCTTTGTGGCCTCAAGCCTGATCCAGGAGCCCTCACAGCAAGATCTG
NM_001006932.1      TTTAGAGGATTCAGCTTTGTGGCCTCAAGCCTGATCCAGGAGCCCTCACAGCAAGATCTG
                    ************************************************************

HsCD00021404        CACAAAGTCCCAGTTCACCCAATCGTGCAGCAGTTACACGGGAACAACATCCACTTCACC
NM_021135.4         CACAAAGTCCCAGTTCACCCAATCGTGCAGCAGTTACACGGGAACAACATCCACTTCACC
NM_001006932.1      CACAAAGTCCCAGTTCACCCAATCGTGCAGCAGTTACACGGGAACAACATCCACTTCACC
                    ************************************************************

HsCD00021404        GATGGCTACGAGATCAAGGAGGACATCGGGGTGGGCTCCTACTCAGTGTGCAAGCGATGT
NM_021135.4         GATGGCTACGAGATCAAGGAGGACATCGGGGTGGGCTCCTACTCAGTGTGCAAGCGATGT
NM_001006932.1      GATGGCTACGAGATCAAGGAGGACATCGGGGTGGGCTCCTACTCAGTGTGCAAGCGATGT
                    ************************************************************

HsCD00021404        GTGCATAAAGCCACAGACACCGAGTATGCCGTGAAGATCATTGATAAGAGCAAGAGAGAC
NM_021135.4         GTGCATAAAGCCACAGACACCGAGTATGCCGTGAAGATCATTGATAAGAGCAAGAGAGAC
NM_001006932.1      GTGCATAAAGCCACAGACACCGAGTATGCCGTGAAGATCATTGATAAGAGCAAGAGAGAC
                    ************************************************************

HsCD00021404        CCCTCGGAAGAGATTGAGATCCTCCTGCGGTACGGCCAGCACCCGAACATCATCACCCTC
NM_021135.4         CCCTCGGAAGAGATTGAGATCCTCCTGCGGTACGGCCAGCACCCGAACATCATCACCCTC
NM_001006932.1      CCCTCGGAAGAGATTGAGATCCTCCTGCGGTACGGCCAGCACCCGAACATCATCACCCTC
                    ************************************************************

HsCD00021404        AAGGATGTCTATGATGATGGCAAGTTTGTGTACCTGGTAATGGAGCTGATGCGTGGTGGG
NM_021135.4         AAGGATGTCTATGATGATGGCAAGTTTGTGTACCTGGTAATGGAGCTGATGCGTGGTGGG
NM_001006932.1      AAGGATGTCTATGATGATGGCAAGTTTGTGTACCTGGTAATGGAGCTGATGCGTGGTGGG
                    ************************************************************

HsCD00021404        GAGCTCCTGGACCGCATCCTCCGGCAGAGATACTTCTCGAAGCGCGAAGCCAGTGACGTC
NM_021135.4         GAGCTCCTGGACCGCATCCTCCGGCAGAGATACTTCTCGGAGCGCGAAGCCAGTGACGTC
NM_001006932.1      GAGCTCCTGGACCGCATCCTCCGGCAGAGATACTTCTCGGAGCGCGAAGCCAGTGACGTC
                    ***************************************.********************

HsCD00021404        CTGTGCACCATCACCAAGACCATGGACTACCTCCATTCCCAGGGGGTTGTTCATCGAGAC
NM_021135.4         CTGTGCACCATCACCAAGACCATGGACTACCTCCATTCCCAGGGGGTTGTTCATCGAGAC
NM_001006932.1      CTGTGCACCATCACCAAGACCATGGACTACCTCCATTCCCAGGGGGTTGTTCATCGAGAC
                    ************************************************************

HsCD00021404        CTGAAGCCGAGTAACATCCTGTACAGGGATGAGTCGGGGAGCCCAGAATCCATCCGAGTC
NM_021135.4         CTGAAGCCGAGTAACATCCTGTACAGGGATGAGTCGGGGAGCCCAGAATCCATCCGAGTC
NM_001006932.1      CTGAAGCCGAGTAACATCCTGTACAGGGATGAGTCGGGGAGCCCAGAATCCATCCGAGTC
                    ************************************************************

HsCD00021404        TGCGACTTCGGCTTTGCCAAGCAGCTGCGCGCGGGGAACGGGCTGCTCATGACACCCTGC
NM_021135.4         TGCGACTTCGGCTTTGCCAAGCAGCTGCGCGCGGGGAACGGGCTGCTCATGACACCCTGC
NM_001006932.1      TGCGACTTCGGCTTTGCCAAGCAGCTGCGCGCGGGGAACGGGCTGCTCATGACACCCTGC
                    ************************************************************

HsCD00021404        TACACGGCCAATTTCGTGGCCCCGGAGGTCCTGAAGCGTCAAGGCTATGATGCGGCGTGT
NM_021135.4         TACACGGCCAATTTCGTGGCCCCGGAGGTCCTGAAGCGTCAAGGCTATGATGCGGCGTGT
NM_001006932.1      TACACGGCCAATTTCGTGGCCCCGGAGGTCCTGAAGCGTCAAGGCTATGATGCGGCGTGT
                    ************************************************************

HsCD00021404        GACATCTGGAGTTTGGGGATCCTGTTGTACACCATGCTGGCAGGATTTACCCCTTTTGCA
NM_021135.4         GACATCTGGAGTTTGGGGATCCTGTTGTACACCATGCTGGCAGGATTTACCCCTTTTGCA
NM_001006932.1      GACATCTGGAGTTTGGGGATCCTGTTGTACACCATGCTGGCAGGATTTACCCCTTTTGCA
                    ************************************************************

HsCD00021404        AATGGGCCAGACGATACCCCTGAGGAGATTCTGGCGCGGATCGGCAGTGGGAAGTATGCC
NM_021135.4         AATGGGCCAGACGATACCCCTGAGGAGATTCTGGCGCGGATCGGCAGTGGGAAGTATGCC
NM_001006932.1      AATGGGCCAGACGATACCCCTGAGGAGATTCTGGCGCGGATCGGCAGTGGGAAGTATGCC
                    ************************************************************

HsCD00021404        CTTTCTGGGGGAAACTGGGACTCGATATCTGACGCAGCTAAAGACGTCGTGTCCAAGATG
NM_021135.4         CTTTCTGGGGGAAACTGGGACTCGATATCTGACGCAGCTAAAGACGTCGTGTCCAAGATG
NM_001006932.1      CTTTCTGGGGGAAACTGGGACTCGATATCTGACGCAGCTAAAGACGTCGTGTCCAAGATG
                    ************************************************************

HsCD00021404        CTCCACGTGGACCCTCATCAGCGCCTGACGGCGATGCAAGTGCTCAAACACCCGTGGGTG
NM_021135.4         CTCCACGTGGACCCTCATCAGCGCCTGACGGCGATGCAAGTGCTCAAACACCCGTGGGTG
NM_001006932.1      CTCCACGTGGACCCTCATCAGCGCCTGACGGCGATGCAAGTGCTCAAACACCCGTGGGTG
                    ************************************************************

HsCD00021404        GTCAACAGAGAGTACCTGTCCCCAAACCAGCTCAGCCGACAGGACGTGCACCTGGTGAAG
NM_021135.4         GTCAACAGAGAGTACCTGTCCCCAAACCAGCTCAGCCGACAGGACGTGCACCTGGTGAAG
NM_001006932.1      GTCAACAGAGAGTACCTGTCCCCAAACCAGCTCAGCCGACAGGACGTGCACCTGGTGAAG
                    ************************************************************

HsCD00021404        GGCGCGATGGCCGCCACCTACTTTGCTCTAAACAGAACACCTCAGGCCCCGCGGCTGGAG
NM_021135.4         GGCGCGATGGCCGCCACCTACTTTGCTCTAAACAGAACACCTCAGGCCCCGCGGCTGGAG
NM_001006932.1      GGCGCGATGGCCGCCACCTACTTTGCTCTAAACAGAACACCTCAGGCCCCGCGGCTGGAG
                    ************************************************************

HsCD00021404        CCCGTGCTGTCGTCCAACCTGGCTCAGCGCAGAGGCATGAAGAGACTCACGTCCACGCGG
NM_021135.4         CCCGTGCTGTCATCCAACCTGGCTCAGCGCAGAGGCATGAAGAGACTCACGTCCACGCGG
NM_001006932.1      CCCGTGCTGTCATCCAACCTGGCTCAGCGCAGAGGCATGAAGAGACTCACGTCCACGCGG
                    ***********.************************************************

HsCD00021404        TTGTAG
NM_021135.4         CTGTAG
NM_001006932.1      CTGTAG
                     *****

Pathways

Panther : Insulin/IGF pathway-mitogen activated protein kinase kinase/MAP kinase cascade
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Ras Pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : Axon guidance
Reactome : CREB phosphorylation
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Developmental Biology
Reactome : ERK/MAPK targets
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : L1CAM interactions
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Post NMDA receptor activation events
Reactome : RSK activation
Reactome : Recycling pathway of L1
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signalling by NGF
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : Transmission across Chemical Synapses
WikiPathway : Cytoplasmic Ribosomal Proteins
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Insulin Signaling
WikiPathway : Prolactin Signaling Pathway

Clone

Cloning Information : 172678
HIP Master Clone ID : 146875
Original Clone ID : FLH172678.01X

Organism


TAX_ID : 9606
Species Specific ID: 6196

Genome

Chromosome : 6
Map Location : 6q27
Ensembl : ENSG00000071242

Reagents

Labome : RPS6KA2-antibody