DNASU Plasmid Repository • 480.965.5697 | Email

RIPK1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RIPK1
Gene Name:  receptor (TNFRSF)-interacting serine-threonine kinase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH173024.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021428

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2016nts         Open reading frame : 1 to 2016
Reference Sequence Alignment

ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
GCAGAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2016
Start on reference sequence 1
Mutations:
None
Discrepancy:
t84c; t1313c,V438A
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RIPK1
Symbol Nomenclature : RIPK1
SYNONYM : RIP; RIP1
Designation : RIP-1|cell death protein RIP|receptor interacting protein|receptor-interacting protein 1|receptor-interacting serine/threonine-protein kinase 1|serine/threonine-protein kinase RIP
Full Nomenclature : receptor (TNFRSF)-interacting serine-threonine kinase 1
GENEID : 8737
HGNC : 10019
MIM : 603453
Vega : OTTHUMG00000014134
Target GenBank: NM_003804

 

Reference Sequence Alignment

  

HsCD00021428        ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
NM_003804.3         ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
XM_005249458.1      ATGCAACCAGACATGTCCTTGAATGTCATTAAGATGAAATCCAGTGACTTCCTGGAGAGT
                    ************************************************************

HsCD00021428        GCAGAACTGGACAGCGGAGGCTTCGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
NM_003804.3         GCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
XM_005249458.1      GCAGAACTGGACAGCGGAGGCTTTGGGAAGGTGTCTCTGTGTTTCCACAGAACCCAGGGA
                    *********************** ************************************

HsCD00021428        CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
NM_003804.3         CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
XM_005249458.1      CTCATGATCATGAAAACAGTGTACAAGGGGCCCAACTGCATTGAGCACAACGAGGCCCTC
                    ************************************************************

HsCD00021428        TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
NM_003804.3         TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
XM_005249458.1      TTGGAGGAGGCGAAGATGATGAACAGACTGAGACACAGCCGGGTGGTGAAGCTCCTGGGC
                    ************************************************************

HsCD00021428        GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
NM_003804.3         GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
XM_005249458.1      GTCATCATAGAGGAAGGGAAGTACTCCCTGGTGATGGAGTACATGGAGAAGGGCAACCTG
                    ************************************************************

HsCD00021428        ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
NM_003804.3         ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
XM_005249458.1      ATGCACGTGCTGAAAGCCGAGATGAGTACTCCGCTTTCTGTAAAAGGAAGGATAATTTTG
                    ************************************************************

HsCD00021428        GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
NM_003804.3         GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
XM_005249458.1      GAAATCATTGAAGGAATGTGCTACTTACATGGAAAAGGCGTGATACACAAGGACCTGAAG
                    ************************************************************

HsCD00021428        CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
NM_003804.3         CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
XM_005249458.1      CCTGAAAATATCCTTGTTGATAATGACTTCCACATTAAGATCGCAGACCTCGGCCTTGCC
                    ************************************************************

HsCD00021428        TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
NM_003804.3         TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
XM_005249458.1      TCCTTTAAGATGTGGAGCAAACTGAATAATGAAGAGCACAATGAGCTGAGGGAAGTGGAC
                    ************************************************************

HsCD00021428        GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
NM_003804.3         GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
XM_005249458.1      GGCACCGCTAAGAAGAATGGCGGCACCCTCTACTACATGGCGCCCGAGCACCTGAATGAC
                    ************************************************************

HsCD00021428        GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
NM_003804.3         GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
XM_005249458.1      GTCAACGCAAAGCCCACAGAGAAGTCGGATGTGTACAGCTTTGCTGTAGTACTCTGGGCG
                    ************************************************************

HsCD00021428        ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
NM_003804.3         ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
XM_005249458.1      ATATTTGCAAATAAGGAGCCATATGAAAATGCTATCTGTGAGCAGCAGTTGATAATGTGC
                    ************************************************************

HsCD00021428        ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
NM_003804.3         ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
XM_005249458.1      ATAAAATCTGGGAACAGGCCAGATGTGGATGACATCACTGAGTACTGCCCAAGAGAAATT
                    ************************************************************

HsCD00021428        ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
NM_003804.3         ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
XM_005249458.1      ATCAGTCTCATGAAGCTCTGCTGGGAAGCGAATCCGGAAGCTCGGCCGACATTTCCTGGC
                    ************************************************************

HsCD00021428        ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
NM_003804.3         ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
XM_005249458.1      ATTGAAGAAAAATTTAGGCCTTTTTATTTAAGTCAATTAGAAGAAAGTGTAGAAGAGGAC
                    ************************************************************

HsCD00021428        GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
NM_003804.3         GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
XM_005249458.1      GTGAAGAGTTTAAAGAAAGAGTATTCAAACGAAAATGCAGTTGTGAAGAGAATGCAGTCT
                    ************************************************************

HsCD00021428        CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
NM_003804.3         CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
XM_005249458.1      CTTCAACTTGATTGTGTGGCAGTACCTTCAAGCCGGTCAAATTCAGCCACAGAACAGCCT
                    ************************************************************

HsCD00021428        GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
NM_003804.3         GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
XM_005249458.1      GGTTCACTGCACAGTTCCCAGGGACTTGGGATGGGTCCTGTGGAGGAGTCCTGGTTTGCT
                    ************************************************************

HsCD00021428        CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
NM_003804.3         CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
XM_005249458.1      CCTTCCCTGGAGCACCCACAAGAAGAGAATGAGCCCAGCCTGCAGAGTAAACTCCAAGAC
                    ************************************************************

HsCD00021428        GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
NM_003804.3         GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
XM_005249458.1      GAAGCCAACTACCATCTTTATGGCAGCCGCATGGACAGGCAGACGAAACAGCAGCCCAGA
                    ************************************************************

HsCD00021428        CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
NM_003804.3         CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
XM_005249458.1      CAGAATGTGGCTTACAACAGAGAGGAGGAAAGGAGACGCAGGGTCTCCCATGACCCTTTT
                    ************************************************************

HsCD00021428        GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
NM_003804.3         GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
XM_005249458.1      GCACAGCAAAGACCTTACGAGAATTTTCAGAATACAGAGGGAAAAGGCACTGCTTATTCC
                    ************************************************************

HsCD00021428        AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
NM_003804.3         AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
XM_005249458.1      AGTGCAGCCAGTCATGGTAATGCAGTGCACCAGCCCTCAGGGCTCACCAGCCAACCTCAA
                    ************************************************************

HsCD00021428        GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
NM_003804.3         GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
XM_005249458.1      GTACTGTATCAGAACAATGGATTATATAGCTCACATGGCTTTGGAACAAGACCACTGGAT
                    ************************************************************

HsCD00021428        CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
NM_003804.3         CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
XM_005249458.1      CCAGGAACAGCAGGTCCCAGAGTTTGGTACAGGCCAATTCCAAGTCATATGCCTAGTCTG
                    ************************************************************

HsCD00021428        CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
NM_003804.3         CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
XM_005249458.1      CATAATATCCCAGTGCCTGAGACCAACTATCTAGGAAATACACCCACCATGCCATTCAGC
                    ************************************************************

HsCD00021428        TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
NM_003804.3         TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
XM_005249458.1      TCCTTGCCACCAACAGATGAATCTATAAAATATACCATATACAATAGTACTGGCATTCAG
                    ************************************************************

HsCD00021428        ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
NM_003804.3         ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
XM_005249458.1      ATTGGAGCCTACAATTATATGGAGATTGGTGGGACGAGTTCATCACTACTAGACAGCACA
                    ************************************************************

HsCD00021428        AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
NM_003804.3         AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
XM_005249458.1      AATACGAACTTCAAAGAAGAGCCAGCTGCTAAGTACCAAGCTATCTTTGATAATACCACT
                    ************************************************************

HsCD00021428        AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
NM_003804.3         AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
XM_005249458.1      AGTCTGACGGATAAACACCTGGACCCAATCAGGGAAAATCTGGGAAAGCACTGGAAAAAC
                    ************************************************************

HsCD00021428        TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
NM_003804.3         TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
XM_005249458.1      TGTGCCCGTAAACTGGGCTTCACACAGTCTCAGATTGATGAAATTGACCATGACTATGAG
                    ************************************************************

HsCD00021428        CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
NM_003804.3         CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
XM_005249458.1      CGAGATGGACTGAAAGAAAAGGTTTACCAGATGCTCCAAAAGTGGGTGATGAGGGAAGGC
                    ************************************************************

HsCD00021428        ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
NM_003804.3         ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
XM_005249458.1      ATAAAGGGAGCCACGGTGGGGAAGCTGGCCCAGGCGCTCCACCAGTGTTCCAGGATCGAC
                    ************************************************************

HsCD00021428        CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTTG
NM_003804.3         CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTAA
XM_005249458.1      CTTCTGAGCAGCTTGATTTACGTCAGCCAGAACTAA
                    **********************************:.

Pathways

NCI : Caspase Cascade in Apoptosis
NCI : Ceramide signaling pathway
NCI : FAS (CD95) signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : Regulation of p38-alpha and p38-beta
NCI : TNF receptor signaling pathway
NCI : TRAIL signaling pathway
Panther : Apoptosis signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Apoptosis
Reactome : Caspase-8 activation
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Death Receptor Signalling
Reactome : Dimerization of procaspase-8
Reactome : Extrinsic Pathway for Apoptosis
Reactome : IKK complex recruitment mediated by RIP1
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : NF-kB activation through FADD/RIP-1 pathway mediated by caspase-8 and -10
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Regulation by c-FLIP
Reactome : TNF signaling
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : TRIF-mediated programmed cell death
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation by HSP70
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway
WikiPathway : p38 MAPK Signaling Pathway

Clone

Cloning Information : 173024
HIP Master Clone ID : 148169
Original Clone ID : FLH173024.01F

Organism


TAX_ID : 9606
Species Specific ID: 8737

Genome

Chromosome : 6
Map Location : 6p25.2
Ensembl : ENSG00000137275

Reagents

Labome : RIP-antibody