DNASU Plasmid Repository • 480.965.5697 | Email

JAK3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  JAK3
Gene Name:  Janus kinase 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH173474.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021445

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3375nts         Open reading frame : 1 to 3375
Reference Sequence Alignment

ATGGCACCTCCAAGTGAAGAGACGCCCCTGATCCCTCAGCGTTCATGCAGCCTCTTGTCC
ACGGAGGCTGGTGCCCTGCATGTGCTGCTGCCCGCTCGGGGCCCCGGGCCCCCCCAGCGC
CTATCTTTCTCCTTTGGGGACCACTTGGCTGAGGACCTGTGCGTGCAGGCTGCCAAGGCC
AGCGGCATCCTGCCTGTGTACCACTCCCTCTTTGCTCTGGCCACGGAGGACCTGTCCTGC
TGGTTCCCCCCGAGCCACATCTTCTCCGTGGAGGATGCCAGCACCCAAGTCCTGCTGTAC
AGGATTCGCTTTTACTTCCCCAATTGGTTTGGGCTGGAGAAGTGCCACCGCTTCGGGCTA
CGCAAGGATTTGGCCAGTGCTATCCTTGACCTGCCAGTCCTGGAGCACCTCTTTGCCCAG
CACCGCAGTGACCTGGTGAGTGGGCGCCTCCCCGTGGGCCTCAGTCTCAAGGAGCAGGGT
GAGTGTCTCAGCCTGGCCGTGTTGGACCTGGCCCGGATGGCGCGAGAGCAGGCCCAGCGG
CCGGGAGAGCTGCTGAAGACTGTCAGCTACAAGGCCTGCCTACCCCCAAGCCTGCGCGAC
CTGATCCAGGGCCTGAGCTTCGTGACGCGGAGGCGTATTCGGAGGACGGTGCGCAGAGCC
CTGCGCCGCGTGGCCGCCTGCCAGGCAGACCGGCACTCGCTCATGGCCAAGTACATCATG
GACCTGGAGCGGCTGGATCCAGCCGGGGCCGCCGAGACCTTCCACGTGGGCCTCCCTGGG
GCCCTTGGTGGCCACGACGGGCTGGGGCTGCTCCGCGTGGCTGGTGACGGCGGCATCGCC
TGGACCCAGGGAGAACAGGAGGTCCTCCAGCCCTTCTGCGACTTTCCAGAAATCGTAGAC
ATTAGCATCAAGCAGGCCCCGCGCGTTGGCCCGGCCGGAGAGCACCGCCTGGTCACTGTT
ACCAGGACAGACAACCAGATTTTAGAGGCCGAGTTCCCAGGGCTGCCCGAGGCTCTGTCG
TTCGTGGCGCTCGTGGACGGCTACTTCCGGCTGACCACGGACTCCCAGCACTTCTTCTGC
AAGGAGGTGGCACCGCCGAGGCTGCTGGAGGAAGTGGCCGAGCAGTGCCACGGCCCCATC
ACTCTGGACTTTGCCATCAACAAGCTCAAGACTGGGGGCTCACGTCCTGGCTCCTATGTT
CTCCGCCGCAGCCCCCAGGACTTTGACAGCTTCCTCCTCACTGTCTGTGTCCAGAACCCC
CTTGGTCCTGATTATAAGGGCTGCCTCATCCGGCGCAGCCCCACAGGAACCTTCCTTCTG
GTTGGCCTCAGCCGACCCCACAGCAGTCTTCGAGAGCTCCTGGCAACCTGCTGGGATGGG
GGGCTGCACGTAGATGGGGTGGCAGTGACCCTCACTTCCTGCTGTATCCCCAGACCCAAA
GAAAAGTCCAACCTGATCGTGGTCCAGAGAGGTCACAGCCCACCCACATCATCCTTGGTT
CAGCCCCAATCCCAATACCAGCTGAGTCAGATGACATTTCACAAGATCCCTGCTGACAGC
CTGGAGTGGCATGAGAACCTGGGCCATGGGTCCTTCACCAAGATTTACCGGGGCTGTCGC
CATGAGGTGGTGGATGGGGAGGCCCGAAAGACAGAGGTGCTGCTGAAGGTCATGGATGCC
AAGCACAAGAACTGCATGGAGTCATTCCTGGAAGCAGCGAGCTTGATGAGCCAAGTGTCG
TACCGGCATCTCGTGCTGCTCCACGGCGTGTGCATGGCTGGAGACAGCACCATGGTGCAG
GAATTTGTACACCTGGGGGCCATAGACATGTATCTGCGAAAACGTGGCCACCTGGTGCCA
GCCAGCTGGAAGCTGCAGGTGGTCAAACAGCTGGCCTACGCCCTCAACTATCTGGAGGAC
AAAGGCCTGCCCCATGGCAATGTCTCTGCCCGGAAGGTGCTCCTGGCTCGGGAGGGGGCT
GATGGGAGCCCGCCCTTCATCAAGCTGAGTGACCCTGGGGTCAGCCCCGCTGTGTTAAGC
CTGGAGATGCTCACCGACAGGATCCCCTGGGTGGCCCCCGAGTGTCTCCGGGAGGCGCAG
ACACTTAGCTTGGAAGCTGACAAGTGGGGCTTCGGCGCCACGGTCTGGGAAGTGTTTAGT
GGCGTCACCATGCCCATCAGTGCCCTGGATCCTGCTAAGAAACTCCAATTTTATGAGGAC
CGGCAGCAGCTGCCGGCCCCCAAGTGGACAGAGCTGGCCCTGCTGATTCAACAGTGCATG
GCCTATGAGCCGGTCCAGAGGCCCTCCTTCCGAGCCGTCATTCGTGACCTCAATAGCCTC
ATCTCTTCAGACTATGAGCTCCTCTCAGACCCCACACCTGGTGCCCTGGCACCTCGTGAT
GGGCTGTGGAATGGTGCCCAGCTCTATGCCTGCCAAGACCCCACGATCTTCGAGGAGAGA
CACCTCAAGTACATCTCACAGCTGGGCAAGGGCAACTTTGGCAGCGTGGAGCTGTGCCGC
TATGACCCGCTAGGCGACAATACAGGTGCCCTGGTGGCCGTGAAACAGCTGCAGCACAGC
GGGCCAGACCAGCAGAGGGACTTTCAGCGGGAGATTCAGATCCTCAAAGCACTGCACAGT
GATTTCATTGTCAAGTATCGTGGTGTCAGCTATGGCCCGGGCCGCCAGAGCCTGCGGCTG
GTCATGGAGTACCTGCCCAGCGGCTGCTTGCGCGACTTCCTGCAGCGGCACCGCGCGCGC
CTCGATGCCAGCCGCCTCCTTCTCTATTCCTCGCAGATCTGCAAGGGCATGGAGTACCTG
GGCTCCCGCCGCTGCGTGCACCGCGACCTGGCCGCCCGAAACATCCTCGTGGAGAGCGAG
GCACACGTCAAGATCGCTGACTTCGGCCTAGCTAAGCTGCTGCCGCTTGACAAAGACTAC
TACGTGGTCCGCGAGCCAGGCCAGAGCCCCATTTTCTGGTATGCCCCCGAATCCCTCTCG
GACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTGTACGAGCTC
TTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATGATGGGATGT
GAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGCCAGAGGCTG
CCGGCGCCTCCTGCCTGCCCTGCTGAGGTTCACGAGCTCATGAAGCTGTGCTGGGCCCCT
AGCCCACAGGACCGGCCATCATTCAGCGCCCTGGGCCCCCAGCTGGACATGCTGTGGAGC
GGAAGCCGGGGGTGTGAGACTCATGCCTTCACTGCTCACCCAGAGGGCAAACACCACTCC
CTGTCCTTTTCATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3434
Start on reference sequence 60
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : JAK3
Symbol Nomenclature : JAK3
SYNONYM : JAK-3; JAK3_HUMAN; JAKL; L-JAK; LJAK
Designation : Janus kinase 3 (a protein tyrosine kinase, leukocyte)|leukocyte Janus kinase|tyrosine-protein kinase JAK3
Full Nomenclature : Janus kinase 3
GENEID : 3718
HGNC : 6193
MIM : 600173
Target GenBank: NM_000215

 

Reference Sequence Alignment

  

HsCD00021445        ------------------------------------------------------------
NM_000215.3         ------------------------------------------------------------
XM_005259896.1      ATGACAGTGGCTCAGGAAACCAAGGGGCCCACACAGGAAGGAGCCGAGTGGGACTTTCCT
                                                                                

HsCD00021445        ------------------------------------------------------------
NM_000215.3         ------------------------------------------------------------
XM_005259896.1      CTCGCTGCCTCCCGGCTCTGCCCGCCCTTCGAAAGTCCAGGGTCCCTGCCCGCTAGGCAA
                                                                                

HsCD00021445        ---------ATGGCACCTCCAAGTGAAGAGACGCCCCTGATCCCTCAGCGTTCATGCAGC
NM_000215.3         ---------ATGGCACCTCCAAGTGAAGAGACGCCCCTGATCCCTCAGCGTTCATGCAGC
XM_005259896.1      GTTGCACTCATGGCACCTCCAAGTGAAGAGACGCCCCTGATCCCTCAGCGTTCATGCAGC
                             ***************************************************

HsCD00021445        CTCTTGTCCACGGAGGCTGGTGCCCTGCATGTGCTGCTGCCCGCTCGGGGCCCCGGGCCC
NM_000215.3         CTCTTGTCCACGGAGGCTGGTGCCCTGCATGTGCTGCTGCCCGCTCGGGGCCCCGGGCCC
XM_005259896.1      CTCTTGTCCACGGAGGCTGGTGCCCTGCATGTGCTGCTGCCCGCTCGGGGCCCCGGGCCC
                    ************************************************************

HsCD00021445        CCCCAGCGCCTATCTTTCTCCTTTGGGGACCACTTGGCTGAGGACCTGTGCGTGCAGGCT
NM_000215.3         CCCCAGCGCCTATCTTTCTCCTTTGGGGACCACTTGGCTGAGGACCTGTGCGTGCAGGCT
XM_005259896.1      CCCCAGCGCCTATCTTTCTCCTTTGGGGACCACTTGGCTGAGGACCTGTGCGTGCAGGCT
                    ************************************************************

HsCD00021445        GCCAAGGCCAGCGGCATCCTGCCTGTGTACCACTCCCTCTTTGCTCTGGCCACGGAGGAC
NM_000215.3         GCCAAGGCCAGCGGCATCCTGCCTGTGTACCACTCCCTCTTTGCTCTGGCCACGGAGGAC
XM_005259896.1      GCCAAGGCCAGCGGCATCCTGCCTGTGTACCACTCCCTCTTTGCTCTGGCCACGGAGGAC
                    ************************************************************

HsCD00021445        CTGTCCTGCTGGTTCCCCCCGAGCCACATCTTCTCCGTGGAGGATGCCAGCACCCAAGTC
NM_000215.3         CTGTCCTGCTGGTTCCCCCCGAGCCACATCTTCTCCGTGGAGGATGCCAGCACCCAAGTC
XM_005259896.1      CTGTCCTGCTGGTTCCCCCCGAGCCACATCTTCTCCGTGGAGGATGCCAGCACCCAAGTC
                    ************************************************************

HsCD00021445        CTGCTGTACAGGATTCGCTTTTACTTCCCCAATTGGTTTGGGCTGGAGAAGTGCCACCGC
NM_000215.3         CTGCTGTACAGGATTCGCTTTTACTTCCCCAATTGGTTTGGGCTGGAGAAGTGCCACCGC
XM_005259896.1      CTGCTGTACAGGATTCGCTTTTACTTCCCCAATTGGTTTGGGCTGGAGAAGTGCCACCGC
                    ************************************************************

HsCD00021445        TTCGGGCTACGCAAGGATTTGGCCAGTGCTATCCTTGACCTGCCAGTCCTGGAGCACCTC
NM_000215.3         TTCGGGCTACGCAAGGATTTGGCCAGTGCTATCCTTGACCTGCCAGTCCTGGAGCACCTC
XM_005259896.1      TTCGGGCTACGCAAGGATTTGGCCAGTGCTATCCTTGACCTGCCAGTCCTGGAGCACCTC
                    ************************************************************

HsCD00021445        TTTGCCCAGCACCGCAGTGACCTGGTGAGTGGGCGCCTCCCCGTGGGCCTCAGTCTCAAG
NM_000215.3         TTTGCCCAGCACCGCAGTGACCTGGTGAGTGGGCGCCTCCCCGTGGGCCTCAGTCTCAAG
XM_005259896.1      TTTGCCCAGCACCGCAGTGACCTGGTGAGTGGGCGCCTCCCCGTGGGCCTCAGTCTCAAG
                    ************************************************************

HsCD00021445        GAGCAGGGTGAGTGTCTCAGCCTGGCCGTGTTGGACCTGGCCCGGATGGCGCGAGAGCAG
NM_000215.3         GAGCAGGGTGAGTGTCTCAGCCTGGCCGTGTTGGACCTGGCCCGGATGGCGCGAGAGCAG
XM_005259896.1      GAGCAGGGTGAGTGTCTCAGCCTGGCCGTGTTGGACCTGGCCCGGATGGCGCGAGAGCAG
                    ************************************************************

HsCD00021445        GCCCAGCGGCCGGGAGAGCTGCTGAAGACTGTCAGCTACAAGGCCTGCCTACCCCCAAGC
NM_000215.3         GCCCAGCGGCCGGGAGAGCTGCTGAAGACTGTCAGCTACAAGGCCTGCCTACCCCCAAGC
XM_005259896.1      GCCCAGCGGCCGGGAGAGCTGCTGAAGACTGTCAGCTACAAGGCCTGCCTACCCCCAAGC
                    ************************************************************

HsCD00021445        CTGCGCGACCTGATCCAGGGCCTGAGCTTCGTGACGCGGAGGCGTATTCGGAGGACGGTG
NM_000215.3         CTGCGCGACCTGATCCAGGGCCTGAGCTTCGTGACGCGGAGGCGTATTCGGAGGACGGTG
XM_005259896.1      CTGCGCGACCTGATCCAGGGCCTGAGCTTCGTGACGCGGAGGCGTATTCGGAGGACGGTG
                    ************************************************************

HsCD00021445        CGCAGAGCCCTGCGCCGCGTGGCCGCCTGCCAGGCAGACCGGCACTCGCTCATGGCCAAG
NM_000215.3         CGCAGAGCCCTGCGCCGCGTGGCCGCCTGCCAGGCAGACCGGCACTCGCTCATGGCCAAG
XM_005259896.1      CGCAGAGCCCTGCGCCGCGTGGCCGCCTGCCAGGCAGACCGGCACTCGCTCATGGCCAAG
                    ************************************************************

HsCD00021445        TACATCATGGACCTGGAGCGGCTGGATCCAGCCGGGGCCGCCGAGACCTTCCACGTGGGC
NM_000215.3         TACATCATGGACCTGGAGCGGCTGGATCCAGCCGGGGCCGCCGAGACCTTCCACGTGGGC
XM_005259896.1      TACATCATGGACCTGGAGCGGCTGGATCCAGCCGGGGCCGCCGAGACCTTCCACGTGGGC
                    ************************************************************

HsCD00021445        CTCCCTGGGGCCCTTGGTGGCCACGACGGGCTGGGGCTGCTCCGCGTGGCTGGTGACGGC
NM_000215.3         CTCCCTGGGGCCCTTGGTGGCCACGACGGGCTGGGGCTGCTCCGCGTGGCTGGTGACGGC
XM_005259896.1      CTCCCTGGGGCCCTTGGTGGCCACGACGGGCTGGGGCTGCTCCGCGTGGCTGGTGACGGC
                    ************************************************************

HsCD00021445        GGCATCGCCTGGACCCAGGGAGAACAGGAGGTCCTCCAGCCCTTCTGCGACTTTCCAGAA
NM_000215.3         GGCATCGCCTGGACCCAGGGAGAACAGGAGGTCCTCCAGCCCTTCTGCGACTTTCCAGAA
XM_005259896.1      GGCATCGCCTGGACCCAGGGAGAACAGGAGGTCCTCCAGCCCTTCTGCGACTTTCCAGAA
                    ************************************************************

HsCD00021445        ATCGTAGACATTAGCATCAAGCAGGCCCCGCGCGTTGGCCCGGCCGGAGAGCACCGCCTG
NM_000215.3         ATCGTAGACATTAGCATCAAGCAGGCCCCGCGCGTTGGCCCGGCCGGAGAGCACCGCCTG
XM_005259896.1      ATCGTAGACATTAGCATCAAGCAGGCCCCGCGCGTTGGCCCGGCCGGAGAGCACCGCCTG
                    ************************************************************

HsCD00021445        GTCACTGTTACCAGGACAGACAACCAGATTTTAGAGGCCGAGTTCCCAGGGCTGCCCGAG
NM_000215.3         GTCACTGTTACCAGGACAGACAACCAGATTTTAGAGGCCGAGTTCCCAGGGCTGCCCGAG
XM_005259896.1      GTCACTGTTACCAGGACAGACAACCAGATTTTAGAGGCCGAGTTCCCAGGGCTGCCCGAG
                    ************************************************************

HsCD00021445        GCTCTGTCGTTCGTGGCGCTCGTGGACGGCTACTTCCGGCTGACCACGGACTCCCAGCAC
NM_000215.3         GCTCTGTCGTTCGTGGCGCTCGTGGACGGCTACTTCCGGCTGACCACGGACTCCCAGCAC
XM_005259896.1      GCTCTGTCGTTCGTGGCGCTCGTGGACGGCTACTTCCGGCTGACCACGGACTCCCAGCAC
                    ************************************************************

HsCD00021445        TTCTTCTGCAAGGAGGTGGCACCGCCGAGGCTGCTGGAGGAAGTGGCCGAGCAGTGCCAC
NM_000215.3         TTCTTCTGCAAGGAGGTGGCACCGCCGAGGCTGCTGGAGGAAGTGGCCGAGCAGTGCCAC
XM_005259896.1      TTCTTCTGCAAGGAGGTGGCACCGCCGAGGCTGCTGGAGGAAGTGGCCGAGCAGTGCCAC
                    ************************************************************

HsCD00021445        GGCCCCATCACTCTGGACTTTGCCATCAACAAGCTCAAGACTGGGGGCTCACGTCCTGGC
NM_000215.3         GGCCCCATCACTCTGGACTTTGCCATCAACAAGCTCAAGACTGGGGGCTCACGTCCTGGC
XM_005259896.1      GGCCCCATCACTCTGGACTTTGCCATCAACAAGCTCAAGACTGGGGGCTCACGTCCTGGC
                    ************************************************************

HsCD00021445        TCCTATGTTCTCCGCCGCAGCCCCCAGGACTTTGACAGCTTCCTCCTCACTGTCTGTGTC
NM_000215.3         TCCTATGTTCTCCGCCGCAGCCCCCAGGACTTTGACAGCTTCCTCCTCACTGTCTGTGTC
XM_005259896.1      TCCTATGTTCTCCGCCGCAGCCCCCAGGACTTTGACAGCTTCCTCCTCACTGTCTGTGTC
                    ************************************************************

HsCD00021445        CAGAACCCCCTTGGTCCTGATTATAAGGGCTGCCTCATCCGGCGCAGCCCCACAGGAACC
NM_000215.3         CAGAACCCCCTTGGTCCTGATTATAAGGGCTGCCTCATCCGGCGCAGCCCCACAGGAACC
XM_005259896.1      CAGAACCCCCTTGGTCCTGATTATAAGGGCTGCCTCATCCGGCGCAGCCCCACAGGAACC
                    ************************************************************

HsCD00021445        TTCCTTCTGGTTGGCCTCAGCCGACCCCACAGCAGTCTTCGAGAGCTCCTGGCAACCTGC
NM_000215.3         TTCCTTCTGGTTGGCCTCAGCCGACCCCACAGCAGTCTTCGAGAGCTCCTGGCAACCTGC
XM_005259896.1      TTCCTTCTGGTTGGCCTCAGCCGACCCCACAGCAGTCTTCGAGAGCTCCTGGCAACCTGC
                    ************************************************************

HsCD00021445        TGGGATGGGGGGCTGCACGTAGATGGGGTGGCAGTGACCCTCACTTCCTGCTGTATCCCC
NM_000215.3         TGGGATGGGGGGCTGCACGTAGATGGGGTGGCAGTGACCCTCACTTCCTGCTGTATCCCC
XM_005259896.1      TGGGATGGGGGGCTGCACGTAGATGGGGTGGCAGTGACCCTCACTTCCTGCTGTATCCCC
                    ************************************************************

HsCD00021445        AGACCCAAAGAAAAGTCCAACCTGATCGTGGTCCAGAGAGGTCACAGCCCACCCACATCA
NM_000215.3         AGACCCAAAGAAAAGTCCAACCTGATCGTGGTCCAGAGAGGTCACAGCCCACCCACATCA
XM_005259896.1      AGACCCAAAGAAAAGTCCAACCTGATCGTGGTCCAGAGAGGTCACAGCCCACCCACATCA
                    ************************************************************

HsCD00021445        TCCTTGGTTCAGCCCCAATCCCAATACCAGCTGAGTCAGATGACATTTCACAAGATCCCT
NM_000215.3         TCCTTGGTTCAGCCCCAATCCCAATACCAGCTGAGTCAGATGACATTTCACAAGATCCCT
XM_005259896.1      TCCTTGGTTCAGCCCCAATCCCAATACCAGCTGAGTCAGATGACATTTCACAAGATCCCT
                    ************************************************************

HsCD00021445        GCTGACAGCCTGGAGTGGCATGAGAACCTGGGCCATGGGTCCTTCACCAAGATTTACCGG
NM_000215.3         GCTGACAGCCTGGAGTGGCATGAGAACCTGGGCCATGGGTCCTTCACCAAGATTTACCGG
XM_005259896.1      GCTGACAGCCTGGAGTGGCATGAGAACCTGGGCCATGGGTCCTTCACCAAGATTTACCGG
                    ************************************************************

HsCD00021445        GGCTGTCGCCATGAGGTGGTGGATGGGGAGGCCCGAAAGACAGAGGTGCTGCTGAAGGTC
NM_000215.3         GGCTGTCGCCATGAGGTGGTGGATGGGGAGGCCCGAAAGACAGAGGTGCTGCTGAAGGTC
XM_005259896.1      GGCTGTCGCCATGAGGTGGTGGATGGGGAGGCCCGAAAGACAGAGGTGCTGCTGAAGGTC
                    ************************************************************

HsCD00021445        ATGGATGCCAAGCACAAGAACTGCATGGAGTCATTCCTGGAAGCAGCGAGCTTGATGAGC
NM_000215.3         ATGGATGCCAAGCACAAGAACTGCATGGAGTCATTCCTGGAAGCAGCGAGCTTGATGAGC
XM_005259896.1      ATGGATGCCAAGCACAAGAACTGCATGGAGTCATTCCTGGAAGCAGCGAGCTTGATGAGC
                    ************************************************************

HsCD00021445        CAAGTGTCGTACCGGCATCTCGTGCTGCTCCACGGCGTGTGCATGGCTGGAGACAGCACC
NM_000215.3         CAAGTGTCGTACCGGCATCTCGTGCTGCTCCACGGCGTGTGCATGGCTGGAGACAGCACC
XM_005259896.1      CAAGTGTCGTACCGGCATCTCGTGCTGCTCCACGGCGTGTGCATGGCTGGAGACAGCACC
                    ************************************************************

HsCD00021445        ATGGTGCAGGAATTTGTACACCTGGGGGCCATAGACATGTATCTGCGAAAACGTGGCCAC
NM_000215.3         ATGGTGCAGGAATTTGTACACCTGGGGGCCATAGACATGTATCTGCGAAAACGTGGCCAC
XM_005259896.1      ATGGTGCAGGAATTTGTACACCTGGGGGCCATAGACATGTATCTGCGAAAACGTGGCCAC
                    ************************************************************

HsCD00021445        CTGGTGCCAGCCAGCTGGAAGCTGCAGGTGGTCAAACAGCTGGCCTACGCCCTCAACTAT
NM_000215.3         CTGGTGCCAGCCAGCTGGAAGCTGCAGGTGGTCAAACAGCTGGCCTACGCCCTCAACTAT
XM_005259896.1      CTGGTGCCAGCCAGCTGGAAGCTGCAGGTGGTCAAACAGCTGGCCTACGCCCTCAACTAT
                    ************************************************************

HsCD00021445        CTGGAGGACAAAGGCCTGCCCCATGGCAATGTCTCTGCCCGGAAGGTGCTCCTGGCTCGG
NM_000215.3         CTGGAGGACAAAGGCCTGCCCCATGGCAATGTCTCTGCCCGGAAGGTGCTCCTGGCTCGG
XM_005259896.1      CTGGAGGACAAAGGCCTGCCCCATGGCAATGTCTCTGCCCGGAAGGTGCTCCTGGCTCGG
                    ************************************************************

HsCD00021445        GAGGGGGCTGATGGGAGCCCGCCCTTCATCAAGCTGAGTGACCCTGGGGTCAGCCCCGCT
NM_000215.3         GAGGGGGCTGATGGGAGCCCGCCCTTCATCAAGCTGAGTGACCCTGGGGTCAGCCCCGCT
XM_005259896.1      GAGGGGGCTGATGGGAGCCCGCCCTTCATCAAGCTGAGTGACCCTGGGGTCAGCCCCGCT
                    ************************************************************

HsCD00021445        GTGTTAAGCCTGGAGATGCTCACCGACAGGATCCCCTGGGTGGCCCCCGAGTGTCTCCGG
NM_000215.3         GTGTTAAGCCTGGAGATGCTCACCGACAGGATCCCCTGGGTGGCCCCCGAGTGTCTCCGG
XM_005259896.1      GTGTTAAGCCTGGAGATGCTCACCGACAGGATCCCCTGGGTGGCCCCCGAGTGTCTCCGG
                    ************************************************************

HsCD00021445        GAGGCGCAGACACTTAGCTTGGAAGCTGACAAGTGGGGCTTCGGCGCCACGGTCTGGGAA
NM_000215.3         GAGGCGCAGACACTTAGCTTGGAAGCTGACAAGTGGGGCTTCGGCGCCACGGTCTGGGAA
XM_005259896.1      GAGGCGCAGACACTTAGCTTGGAAGCTGACAAGTGGGGCTTCGGCGCCACGGTCTGGGAA
                    ************************************************************

HsCD00021445        GTGTTTAGTGGCGTCACCATGCCCATCAGTGCCCTGGATCCTGCTAAGAAACTCCAATTT
NM_000215.3         GTGTTTAGTGGCGTCACCATGCCCATCAGTGCCCTGGATCCTGCTAAGAAACTCCAATTT
XM_005259896.1      GTGTTTAGTGGCGTCACCATGCCCATCAGTGCCCTGGATCCTGCTAAGAAACTCCAATTT
                    ************************************************************

HsCD00021445        TATGAGGACCGGCAGCAGCTGCCGGCCCCCAAGTGGACAGAGCTGGCCCTGCTGATTCAA
NM_000215.3         TATGAGGACCGGCAGCAGCTGCCGGCCCCCAAGTGGACAGAGCTGGCCCTGCTGATTCAA
XM_005259896.1      TATGAGGACCGGCAGCAGCTGCCGGCCCCCAAGTGGACAGAGCTGGCCCTGCTGATTCAA
                    ************************************************************

HsCD00021445        CAGTGCATGGCCTATGAGCCGGTCCAGAGGCCCTCCTTCCGAGCCGTCATTCGTGACCTC
NM_000215.3         CAGTGCATGGCCTATGAGCCGGTCCAGAGGCCCTCCTTCCGAGCCGTCATTCGTGACCTC
XM_005259896.1      CAGTGCATGGCCTATGAGCCGGTCCAGAGGCCCTCCTTCCGAGCCGTCATTCGTGACCTC
                    ************************************************************

HsCD00021445        AATAGCCTCATCTCTTCAGACTATGAGCTCCTCTCAGACCCCACACCTGGTGCCCTGGCA
NM_000215.3         AATAGCCTCATCTCTTCAGACTATGAGCTCCTCTCAGACCCCACACCTGGTGCCCTGGCA
XM_005259896.1      AATAGCCTCATCTCTTCAGACTATGAGCTCCTCTCAGACCCCACACCTGGTGCCCTGGCA
                    ************************************************************

HsCD00021445        CCTCGTGATGGGCTGTGGAATGGTGCCCAGCTCTATGCCTGCCAAGACCCCACGATCTTC
NM_000215.3         CCTCGTGATGGGCTGTGGAATGGTGCCCAGCTCTATGCCTGCCAAGACCCCACGATCTTC
XM_005259896.1      CCTCGTGATGGGCTGTGGAATGGTGCCCAGCTCTATGCCTGCCAAGACCCCACGATCTTC
                    ************************************************************

HsCD00021445        GAGGAGAGACACCTCAAGTACATCTCACAGCTGGGCAAGGGCAACTTTGGCAGCGTGGAG
NM_000215.3         GAGGAGAGACACCTCAAGTACATCTCACAGCTGGGCAAGGGCAACTTTGGCAGCGTGGAG
XM_005259896.1      GAGGAGAGACACCTCAAGTACATCTCACAGCTGGGCAAGGGCAACTTTGGCAGCGTGGAG
                    ************************************************************

HsCD00021445        CTGTGCCGCTATGACCCGCTAGGCGACAATACAGGTGCCCTGGTGGCCGTGAAACAGCTG
NM_000215.3         CTGTGCCGCTATGACCCGCTAGGCGACAATACAGGTGCCCTGGTGGCCGTGAAACAGCTG
XM_005259896.1      CTGTGCCGCTATGACCCGCTAGGCGACAATACAGGTGCCCTGGTGGCCGTGAAACAGCTG
                    ************************************************************

HsCD00021445        CAGCACAGCGGGCCAGACCAGCAGAGGGACTTTCAGCGGGAGATTCAGATCCTCAAAGCA
NM_000215.3         CAGCACAGCGGGCCAGACCAGCAGAGGGACTTTCAGCGGGAGATTCAGATCCTCAAAGCA
XM_005259896.1      CAGCACAGCGGGCCAGACCAGCAGAGGGACTTTCAGCGGGAGATTCAGATCCTCAAAGCA
                    ************************************************************

HsCD00021445        CTGCACAGTGATTTCATTGTCAAGTATCGTGGTGTCAGCTATGGCCCGGGCCGCCAGAGC
NM_000215.3         CTGCACAGTGATTTCATTGTCAAGTATCGTGGTGTCAGCTATGGCCCGGGCCGCCAGAGC
XM_005259896.1      CTGCACAGTGATTTCATTGTCAAGTATCGTGGTGTCAGCTATGGCCCGGGCCGCCAGAGC
                    ************************************************************

HsCD00021445        CTGCGGCTGGTCATGGAGTACCTGCCCAGCGGCTGCTTGCGCGACTTCCTGCAGCGGCAC
NM_000215.3         CTGCGGCTGGTCATGGAGTACCTGCCCAGCGGCTGCTTGCGCGACTTCCTGCAGCGGCAC
XM_005259896.1      CTGCGGCTGGTCATGGAGTACCTGCCCAGCGGCTGCTTGCGCGACTTCCTGCAGCGGCAC
                    ************************************************************

HsCD00021445        CGCGCGCGCCTCGATGCCAGCCGCCTCCTTCTCTATTCCTCGCAGATCTGCAAGGGCATG
NM_000215.3         CGCGCGCGCCTCGATGCCAGCCGCCTCCTTCTCTATTCCTCGCAGATCTGCAAGGGCATG
XM_005259896.1      CGCGCGCGCCTCGATGCCAGCCGCCTCCTTCTCTATTCCTCGCAGATCTGCAAGGGCATG
                    ************************************************************

HsCD00021445        GAGTACCTGGGCTCCCGCCGCTGCGTGCACCGCGACCTGGCCGCCCGAAACATCCTCGTG
NM_000215.3         GAGTACCTGGGCTCCCGCCGCTGCGTGCACCGCGACCTGGCCGCCCGAAACATCCTCGTG
XM_005259896.1      GAGTACCTGGGCTCCCGCCGCTGCGTGCACCGCGACCTGGCCGCCCGAAACATCCTCGTG
                    ************************************************************

HsCD00021445        GAGAGCGAGGCACACGTCAAGATCGCTGACTTCGGCCTAGCTAAGCTGCTGCCGCTTGAC
NM_000215.3         GAGAGCGAGGCACACGTCAAGATCGCTGACTTCGGCCTAGCTAAGCTGCTGCCGCTTGAC
XM_005259896.1      GAGAGCGAGGCACACGTCAAGATCGCTGACTTCGGCCTAGCTAAGCTGCTGCCGCTTGAC
                    ************************************************************

HsCD00021445        AAAGACTACTACGTGGTCCGCGAGCCAGGCCAGAGCCCCATTTTCTGGTATGCCCCCGAA
NM_000215.3         AAAGACTACTACGTGGTCCGCGAGCCAGGCCAGAGCCCCATTTTCTGGTATGCCCCCGAA
XM_005259896.1      AAAGACTACTACGTGGTCCGCGAGCCAGGCCAGAGCCCCATTTTCTGGTATGCCCCCGAA
                    ************************************************************

HsCD00021445        TCCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTG
NM_000215.3         TCCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTG
XM_005259896.1      TCCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTG
                    ************************************************************

HsCD00021445        TACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATG
NM_000215.3         TACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATG
XM_005259896.1      TACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATG
                    ************************************************************

HsCD00021445        ATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGC
NM_000215.3         ATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGC
XM_005259896.1      ATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGC
                    ************************************************************

HsCD00021445        CAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTTCACGAGCTCATGAAGCTGTGC
NM_000215.3         CAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTTCACGAGCTCATGAAGCTGTGC
XM_005259896.1      CAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTTCACGAGCTCATGAAGCTGTGC
                    ************************************************************

HsCD00021445        TGGGCCCCTAGCCCACAGGACCGGCCATCATTCAGCGCCCTGGGCCCCCAGCTGGACATG
NM_000215.3         TGGGCCCCTAGCCCACAGGACCGGCCATCATTCAGCGCCCTGGGCCCCCAGCTGGACATG
XM_005259896.1      TGGGCCCCTAGCCCACAGGACCGGCCATCATTCAGCGCCCTGGGCCCCCAGCTGGACATG
                    ************************************************************

HsCD00021445        CTGTGGAGCGGAAGCCGGGGGTGTGAGACTCATGCCTTCACTGCTCACCCAGAGGGCAAA
NM_000215.3         CTGTGGAGCGGAAGCCGGGGGTGTGAGACTCATGCCTTCACTGCTCACCCAGAGGGCAAA
XM_005259896.1      CTGTGGAGCGGAAGCCGGGGGTGTGAGACTCATGCCTTCACTGCTCACCCAGAGGGCAAA
                    ************************************************************

HsCD00021445        CACCACTCCCTGTCCTTTTCATTG
NM_000215.3         CACCACTCCCTGTCCTTTTCATAG
XM_005259896.1      CACCACTCCCTGTCCTTTTCATAG
                    **********************:*

Pathways

NCI : CD40/CD40L signaling
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL4-mediated signaling events
NCI : SHP2 signaling
NCI : Signaling events mediated by TCPTP
Panther : Interleukin signaling pathway
Panther : JAK/STAT signaling pathway
Panther : PDGF signaling pathway
Reactome : Cytokine Signaling in Immune system
Reactome : Immune System
Reactome : Interleukin receptor SHC signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Interleukin-7 signaling
Reactome : Signaling by Interleukins
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : IL-9 signaling pathway

Clone

Cloning Information : 173474
HIP Master Clone ID : 148619
Original Clone ID : FLH173474.01F

Organism


TAX_ID : 9606
Species Specific ID: 3718

Genome

Chromosome : 19
Map Location : 19p13.1
Ensembl : ENSG00000105639

Reagents

Labome : Jak3-antibody