DNASU Plasmid Repository • 480.965.5697 | Email

PRKCB1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PRKCB
Gene Name:  protein kinase C, beta
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH203756.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021485

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2022nts         Open reading frame : 1 to 2022
Reference Sequence Alignment

ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
GCTTGTGGGCGAAATGCTGAAAACTTCGACCGATTTTTCACCCGCCATCCACCAGTCCTA
ACACCTCCCGACCAGGAAGTCATCAGGAATATTGACCAATCAGAATTCGAAGGATTTTCC
TTTGTTAACTCTGAATTTTTAAAACCCGAAGTCAAGAGCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2179
Start on reference sequence 158
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PRKCB
Symbol Nomenclature : PRKCB
SYNONYM : PKC-beta; PKCB; PRKCB1; PRKCB2
Designation : PKC-B|protein kinase C beta type|protein kinase C, beta 1 polypeptide
Full Nomenclature : protein kinase C, beta
GENEID : 5579
HGNC : 9395
MIM : 176970
Vega : OTTHUMG00000131615
Target GenBank: BC036472

 

Reference Sequence Alignment

  

HsCD00021485      ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
NM_002738.6       ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
NM_212535.2       ATGGCTGACCCGGCTGCGGGGCCGCCGCCGAGCGAGGGCGAGGAGAGCACCGTGCGCTTC
                  ************************************************************

HsCD00021485      GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
NM_002738.6       GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
NM_212535.2       GCCCGCAAAGGCGCCCTCCGGCAGAAGAACGTGCATGAGGTCAAGAACCACAAATTCACC
                  ************************************************************

HsCD00021485      GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
NM_002738.6       GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
NM_212535.2       GCCCGCTTCTTCAAGCAGCCCACCTTCTGCAGCCACTGCACCGACTTCATCTGGGGCTTC
                  ************************************************************

HsCD00021485      GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
NM_002738.6       GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
NM_212535.2       GGGAAGCAGGGATTCCAGTGCCAAGTTTGCTGCTTTGTGGTGCACAAGCGGTGCCATGAA
                  ************************************************************

HsCD00021485      TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
NM_002738.6       TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
NM_212535.2       TTTGTCACATTCTCCTGCCCTGGCGCTGACAAGGGTCCAGCCTCCGATGACCCCCGCAGC
                  ************************************************************

HsCD00021485      AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
NM_002738.6       AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
NM_212535.2       AAACACAAGTTTAAGATCCACACGTACTCCAGCCCCACGTTTTGTGACCACTGTGGGTCA
                  ************************************************************

HsCD00021485      CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
NM_002738.6       CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
NM_212535.2       CTGCTGTATGGACTCATCCACCAGGGGATGAAATGTGACACCTGCATGATGAATGTGCAC
                  ************************************************************

HsCD00021485      AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
NM_002738.6       AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
NM_212535.2       AAGCGCTGCGTGATGAATGTTCCCAGCCTGTGTGGCACGGACCACACGGAGCGCCGCGGC
                  ************************************************************

HsCD00021485      CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
NM_002738.6       CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
NM_212535.2       CGCATCTACATCCAGGCCCACATCGACAGGGACGTCCTCATTGTCCTCGTAAGAGATGCT
                  ************************************************************

HsCD00021485      AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
NM_002738.6       AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
NM_212535.2       AAAAACCTTGTACCTATGGACCCCAATGGCCTGTCAGATCCCTACGTAAAACTGAAACTG
                  ************************************************************

HsCD00021485      ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
NM_002738.6       ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
NM_212535.2       ATTCCCGATCCCAAAAGTGAGAGCAAACAGAAGACCAAAACCATCAAATGCTCCCTCAAC
                  ************************************************************

HsCD00021485      CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
NM_002738.6       CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
NM_212535.2       CCTGAGTGGAATGAGACATTTAGATTTCAGCTGAAAGAATCGGACAAAGACAGAAGACTG
                  ************************************************************

HsCD00021485      TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
NM_002738.6       TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
NM_212535.2       TCAGTAGAGATTTGGGATTGGGATTTGACCAGCAGGAATGACTTCATGGGATCTTTGTCC
                  ************************************************************

HsCD00021485      TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
NM_002738.6       TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
NM_212535.2       TTTGGGATTTCTGAACTTCAGAAAGCCAGTGTTGATGGCTGGTTTAAGTTACTGAGCCAG
                  ************************************************************

HsCD00021485      GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
NM_002738.6       GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
NM_212535.2       GAGGAAGGCGAGTACTTCAATGTGCCTGTGCCACCAGAAGGAAGTGAGGCCAATGAAGAA
                  ************************************************************

HsCD00021485      CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
NM_002738.6       CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
NM_212535.2       CTGCGGCAGAAATTTGAGAGGGCCAAGATCAGTCAGGGAACCAAGGTCCCGGAAGAAAAG
                  ************************************************************

HsCD00021485      ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
NM_002738.6       ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
NM_212535.2       ACGACCAACACTGTCTCCAAATTTGACAACAATGGCAACAGAGACCGGATGAAACTGACC
                  ************************************************************

HsCD00021485      GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
NM_002738.6       GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
NM_212535.2       GATTTTAACTTCCTAATGGTGCTGGGGAAAGGCAGCTTTGGCAAGGTCATGCTTTCAGAA
                  ************************************************************

HsCD00021485      CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
NM_002738.6       CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
NM_212535.2       CGAAAAGGCACAGATGAGCTCTATGCTGTGAAGATCCTGAAGAAGGACGTTGTGATCCAA
                  ************************************************************

HsCD00021485      GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
NM_002738.6       GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
NM_212535.2       GATGATGACGTGGAGTGCACTATGGTGGAGAAGCGGGTGTTGGCCCTGCCTGGGAAGCCG
                  ************************************************************

HsCD00021485      CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
NM_002738.6       CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
NM_212535.2       CCCTTCCTGACCCAGCTCCACTCCTGCTTCCAGACCATGGACCGCCTGTACTTTGTGATG
                  ************************************************************

HsCD00021485      GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
NM_002738.6       GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
NM_212535.2       GAGTACGTGAATGGGGGCGACCTCATGTATCACATCCAGCAAGTCGGCCGGTTCAAGGAG
                  ************************************************************

HsCD00021485      CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
NM_002738.6       CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
NM_212535.2       CCCCATGCTGTATTTTACGCTGCAGAAATTGCCATCGGTCTGTTCTTCTTACAGAGTAAG
                  ************************************************************

HsCD00021485      GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
NM_002738.6       GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
NM_212535.2       GGCATCATTTACCGTGACCTAAAACTTGACAACGTGATGCTCGATTCTGAGGGACACATC
                  ************************************************************

HsCD00021485      AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
NM_002738.6       AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
NM_212535.2       AAGATTGCCGATTTTGGCATGTGTAAGGAAAACATCTGGGATGGGGTGACAACCAAGACA
                  ************************************************************

HsCD00021485      TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
NM_002738.6       TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
NM_212535.2       TTCTGTGGCACTCCAGACTACATCGCCCCCGAGATAATTGCTTATCAGCCCTATGGGAAG
                  ************************************************************

HsCD00021485      TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
NM_002738.6       TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
NM_212535.2       TCCGTGGATTGGTGGGCATTTGGAGTCCTGCTGTATGAAATGTTGGCTGGGCAGGCACCC
                  ************************************************************

HsCD00021485      TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
NM_002738.6       TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
NM_212535.2       TTTGAAGGGGAGGATGAAGATGAACTCTTCCAATCCATCATGGAACACAACGTAGCCTAT
                  ************************************************************

HsCD00021485      CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
NM_002738.6       CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
NM_212535.2       CCCAAGTCTATGTCCAAGGAAGCTGTGGCCATCTGCAAAGGGCTGATGACCAAACACCCA
                  ************************************************************

HsCD00021485      GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
NM_002738.6       GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
NM_212535.2       GGCAAACGTCTGGGTTGTGGACCTGAAGGCGAACGTGATATCAAAGAGCATGCATTTTTC
                  ************************************************************

HsCD00021485      CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
NM_002738.6       CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
NM_212535.2       CGGTATATTGATTGGGAGAAACTTGAACGCAAAGAGATCCAGCCCCCTTATAAGCCAAAA
                  ************************************************************

HsCD00021485      GCTTGTGGGCG---AAATGCTGAAAACTTCGACCGATTTTTCACCCGCCATCCACCAGTC
NM_002738.6       GCTTGTGGGCG---AAATGCTGAAAACTTCGACCGATTTTTCACCCGCCATCCACCAGTC
NM_212535.2       GCTAGAGACAAGAGAGACACCTCCAACTTCGACAAAGAGTTCACCAGACAGCCTGTGGAA
                  ***:*:*. ..   *.* .*  ..*********..* : ******.*.** **:  .*:.

HsCD00021485      CTAACACCTCCCGACCAGGAAGTCATCAGGAATATTGACCAATCAGAATTCGAAGGATTT
NM_002738.6       CTAACACCTCCCGACCAGGAAGTCATCAGGAATATTGACCAATCAGAATTCGAAGGATTT
NM_212535.2       CTGACCCCCACTGATAAACTCTTCATCATGAACTTGGACCAAAATGAATTTGCTGGCTTC
                  **.**.** .* ** .*. :. ****** *** :* ******:.:***** *.:**.** 

HsCD00021485      TCCTTTGTTAACTCTGAATTTTTAAAACCCGAAGTCAAGAGCTTG
NM_002738.6       TCCTTTGTTAACTCTGAATTTTTAAAACCCGAAGTCAAGAGCTAA
NM_212535.2       TCTTATACTAACCCAGAGTTTGTCATTAATGTGTAG---------
                  ** *:*. **** *:**.*** *.*::.. *:. :          

Pathways

NCI : Downstream signaling in naïve CD8+ T cells
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : IL2-mediated signaling events
NCI : JNK signaling in the CD4+ TCR pathway
NCI : Ras signaling in the CD4+ TCR pathway
NCI : Regulation of Ras family activation
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Angiogenesis
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : EGF receptor signaling pathway
Panther : Endothelin signaling pathway
Panther : FGF signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Metabotropic glutamate receptor group I pathway
Panther : Muscarinic acetylcholine receptor 1 and 3 signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : VEGF signaling pathway
Panther : Wnt signaling pathway
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Depolymerisation of the Nuclear Lamina
Reactome : Disinhibition of SNARE formation
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : G alpha (z) signalling events
Reactome : GPCR downstream signaling
Reactome : Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity
Reactome : Hemostasis
Reactome : Immune System
Reactome : M Phase
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prophase
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Nuclear Envelope Breakdown
Reactome : PCP/CE pathway
Reactome : Platelet activation, signaling and aggregation
Reactome : Response to elevated platelet cytosolic Ca2+
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Trafficking of AMPA receptors
Reactome : Trafficking of GluR2-containing AMPA receptors
Reactome : Transmission across Chemical Synapses
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Myometrial Relaxation and Contraction Pathways
WikiPathway : Physiological and Pathological Hypertrophy of the Heart
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency
WikiPathway : miRs in Muscle Cell Differentiation

Clone

Cloning Information : 203756
HIP Master Clone ID : 178101
Original Clone ID : FLH203756.01F

Organism


TAX_ID : 9606
Species Specific ID: 5579

Genome

Chromosome : 16
Map Location : 16p11.2
Ensembl : ENSG00000166501

Reagents

Labome : PKC-beta-antibody