DNASU Plasmid Repository • 480.965.5697 | Email

SYK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SYK
Gene Name:  spleen tyrosine kinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH203942.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021523

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1908nts         Open reading frame : 1 to 1908
Reference Sequence Alignment

ATGGCCAGCAGCGGCATGGCTGACAGCGCCAACCACCTGCCCTTCTTTTTCGGCAACATC
ACCCGGGAGGAGGCAGAAGATTACCTGGTCCAGGGGGGCATGAGTGATGGGCTTTATTTG
CTGCGCCAGAGCCGCAACTACCTGGGTGGCTTCGCCCTGTCCGTGGCCCACGGGAGGAAG
GCACACCACTACACCATCGAGCGGGAGCTGAATGGCACCTACGCCATCGCCGGTGGCAGG
ACCCATGCCAGCCCCGCCGACCTCTGCCACTACCACTCCCAGGAGTCTGATGGCCTGGTC
TGCCTCCTCAAGAAGCCCTTCAACCGGCCCCAAGGGGTGCAGCCCAAGACTGGGCCCTTT
GAGGATTTGAAGGAAAACCTCATCAGGGAATATGTGAAGCAGACATGGAACCTGCAGGGT
CAGGCTCTGGAGCAGGCCATCATCAGTCAGAAGCCTCAGCTGGAGAAGCTGATCGCTACC
ACAGCCCATGAAAAAATGCCTTGGTTCCATGGAAAAATCTCTCGGGAAGAATCTGAGCAA
ATTGTCCTGATAGGATCAAAGACAAATGGAAAGTTCCTGATCCGAGCCAGAGACAACAAC
GGCTCCTACGCCCTGTGCCTGCTGCACGAAGGGAAGGTGCTGCACTATCGCATCGACAAA
GACAAGACAGGGAAGCTCTCCATCCCCGAGGGAAAGAAGTTCGACACGCTCTGGCAGCTA
GTCGAGCATTATTCTTATAAAGCAGATGGTTTGTTAAGAGTTCTTACTGTCCCATGTCAA
AAAATCGGCACACAGGGAAATGTTAATTTTGGAGGCCGTCCACAACTTCCAGGTTCCCAT
CCTGCGACTTGGTCAGCGGGTGGAATAATCTCAAGAATCAAATCATACTCCTTCCCAAAG
CCTGGCCACAGAAAGTCCTCCCCTGCCCAAGGGAACCGGCAAGAGAGTACTGTGTCATTC
AATCCGTATGAGCCAGAACTTGCACCCTGGGCTGCAGACAAAGGCCCCCAGAGAGAAGCC
CTACCCATGGACACAGAGGTGTACGAGAGCCCCTACGCGGACCCTGAGGAGATCAGGCCC
AAGGAGGTTTACCTGGACCGAAAGCTGCTGACGCTGGAAGACAAAGAACTGGGCTCTGGT
AATTTTGGAACTGTGAAAAAGGGCTACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCT
GTGAAAATACTGAAAAACGAGGCCAATGACCCCGCTCTTAAAGATGAGTTATTAGCAGAA
GCAAATGTCATGCAGCAGCTGGACAACCCGTACATCGTGCGCATGATCGGGATATGCGAG
GCCGAGTCCTGGATGCTAGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTG
CAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATG
GGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTG
TTGCTAGTTACCCAACATTATGCCAAGATCAGTGATTTCGGACTCTCCAAAGCACTGCGT
GCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCT
CCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTG
TTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGAAAGGAAGTGAA
GTCACCGCTATGTTAGAGAAAGGAGAGCGGATGGGGTGCCCTGCAGGGTGTCCAAGAGAG
ATGTACGATCTCATGAATCTGTGCTGGACATACGATGTGGAAAACAGGCCCGGATTCGCA
GCAGTGGAACTGCGGCTGCGCAATTACTACTATGACGTGGTGAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2055
Start on reference sequence 148
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SYK
Symbol Nomenclature : SYK
SYNONYM : p72-Syk
Designation : tyrosine-protein kinase SYK
Full Nomenclature : spleen tyrosine kinase
GENEID : 6850
HGNC : 11491
MIM : 600085
Vega : OTTHUMG00000020200
Target GenBank: BC002962

 

Reference Sequence Alignment

  

HsCD00021523        ATGGCCAGCAGCGGCATGGCTGACAGCGCCAACCACCTGCCCTTCTTTTTCGGCAACATC
NM_003177.5         ATGGCCAGCAGCGGCATGGCTGACAGCGCCAACCACCTGCCCTTCTTTTTCGGCAACATC
NM_001135052.2      ATGGCCAGCAGCGGCATGGCTGACAGCGCCAACCACCTGCCCTTCTTTTTCGGCAACATC
NM_001174168.1      ATGGCCAGCAGCGGCATGGCTGACAGCGCCAACCACCTGCCCTTCTTTTTCGGCAACATC
NM_001174167.1      ATGGCCAGCAGCGGCATGGCTGACAGCGCCAACCACCTGCCCTTCTTTTTCGGCAACATC
                    ************************************************************

HsCD00021523        ACCCGGGAGGAGGCAGAAGATTACCTGGTCCAGGGGGGCATGAGTGATGGGCTTTATTTG
NM_003177.5         ACCCGGGAGGAGGCAGAAGATTACCTGGTCCAGGGGGGCATGAGTGATGGGCTTTATTTG
NM_001135052.2      ACCCGGGAGGAGGCAGAAGATTACCTGGTCCAGGGGGGCATGAGTGATGGGCTTTATTTG
NM_001174168.1      ACCCGGGAGGAGGCAGAAGATTACCTGGTCCAGGGGGGCATGAGTGATGGGCTTTATTTG
NM_001174167.1      ACCCGGGAGGAGGCAGAAGATTACCTGGTCCAGGGGGGCATGAGTGATGGGCTTTATTTG
                    ************************************************************

HsCD00021523        CTGCGCCAGAGCCGCAACTACCTGGGTGGCTTCGCCCTGTCCGTGGCCCACGGGAGGAAG
NM_003177.5         CTGCGCCAGAGCCGCAACTACCTGGGTGGCTTCGCCCTGTCCGTGGCCCACGGGAGGAAG
NM_001135052.2      CTGCGCCAGAGCCGCAACTACCTGGGTGGCTTCGCCCTGTCCGTGGCCCACGGGAGGAAG
NM_001174168.1      CTGCGCCAGAGCCGCAACTACCTGGGTGGCTTCGCCCTGTCCGTGGCCCACGGGAGGAAG
NM_001174167.1      CTGCGCCAGAGCCGCAACTACCTGGGTGGCTTCGCCCTGTCCGTGGCCCACGGGAGGAAG
                    ************************************************************

HsCD00021523        GCACACCACTACACCATCGAGCGGGAGCTGAATGGCACCTACGCCATCGCCGGTGGCAGG
NM_003177.5         GCACACCACTACACCATCGAGCGGGAGCTGAATGGCACCTACGCCATCGCCGGTGGCAGG
NM_001135052.2      GCACACCACTACACCATCGAGCGGGAGCTGAATGGCACCTACGCCATCGCCGGTGGCAGG
NM_001174168.1      GCACACCACTACACCATCGAGCGGGAGCTGAATGGCACCTACGCCATCGCCGGTGGCAGG
NM_001174167.1      GCACACCACTACACCATCGAGCGGGAGCTGAATGGCACCTACGCCATCGCCGGTGGCAGG
                    ************************************************************

HsCD00021523        ACCCATGCCAGCCCCGCCGACCTCTGCCACTACCACTCCCAGGAGTCTGATGGCCTGGTC
NM_003177.5         ACCCATGCCAGCCCCGCCGACCTCTGCCACTACCACTCCCAGGAGTCTGATGGCCTGGTC
NM_001135052.2      ACCCATGCCAGCCCCGCCGACCTCTGCCACTACCACTCCCAGGAGTCTGATGGCCTGGTC
NM_001174168.1      ACCCATGCCAGCCCCGCCGACCTCTGCCACTACCACTCCCAGGAGTCTGATGGCCTGGTC
NM_001174167.1      ACCCATGCCAGCCCCGCCGACCTCTGCCACTACCACTCCCAGGAGTCTGATGGCCTGGTC
                    ************************************************************

HsCD00021523        TGCCTCCTCAAGAAGCCCTTCAACCGGCCCCAAGGGGTGCAGCCCAAGACTGGGCCCTTT
NM_003177.5         TGCCTCCTCAAGAAGCCCTTCAACCGGCCCCAAGGGGTGCAGCCCAAGACTGGGCCCTTT
NM_001135052.2      TGCCTCCTCAAGAAGCCCTTCAACCGGCCCCAAGGGGTGCAGCCCAAGACTGGGCCCTTT
NM_001174168.1      TGCCTCCTCAAGAAGCCCTTCAACCGGCCCCAAGGGGTGCAGCCCAAGACTGGGCCCTTT
NM_001174167.1      TGCCTCCTCAAGAAGCCCTTCAACCGGCCCCAAGGGGTGCAGCCCAAGACTGGGCCCTTT
                    ************************************************************

HsCD00021523        GAGGATTTGAAGGAAAACCTCATCAGGGAATATGTGAAGCAGACATGGAACCTGCAGGGT
NM_003177.5         GAGGATTTGAAGGAAAACCTCATCAGGGAATATGTGAAGCAGACATGGAACCTGCAGGGT
NM_001135052.2      GAGGATTTGAAGGAAAACCTCATCAGGGAATATGTGAAGCAGACATGGAACCTGCAGGGT
NM_001174168.1      GAGGATTTGAAGGAAAACCTCATCAGGGAATATGTGAAGCAGACATGGAACCTGCAGGGT
NM_001174167.1      GAGGATTTGAAGGAAAACCTCATCAGGGAATATGTGAAGCAGACATGGAACCTGCAGGGT
                    ************************************************************

HsCD00021523        CAGGCTCTGGAGCAGGCCATCATCAGTCAGAAGCCTCAGCTGGAGAAGCTGATCGCTACC
NM_003177.5         CAGGCTCTGGAGCAGGCCATCATCAGTCAGAAGCCTCAGCTGGAGAAGCTGATCGCTACC
NM_001135052.2      CAGGCTCTGGAGCAGGCCATCATCAGTCAGAAGCCTCAGCTGGAGAAGCTGATCGCTACC
NM_001174168.1      CAGGCTCTGGAGCAGGCCATCATCAGTCAGAAGCCTCAGCTGGAGAAGCTGATCGCTACC
NM_001174167.1      CAGGCTCTGGAGCAGGCCATCATCAGTCAGAAGCCTCAGCTGGAGAAGCTGATCGCTACC
                    ************************************************************

HsCD00021523        ACAGCCCATGAAAAAATGCCTTGGTTCCATGGAAAAATCTCTCGGGAAGAATCTGAGCAA
NM_003177.5         ACAGCCCATGAAAAAATGCCTTGGTTCCATGGAAAAATCTCTCGGGAAGAATCTGAGCAA
NM_001135052.2      ACAGCCCATGAAAAAATGCCTTGGTTCCATGGAAAAATCTCTCGGGAAGAATCTGAGCAA
NM_001174168.1      ACAGCCCATGAAAAAATGCCTTGGTTCCATGGAAAAATCTCTCGGGAAGAATCTGAGCAA
NM_001174167.1      ACAGCCCATGAAAAAATGCCTTGGTTCCATGGAAAAATCTCTCGGGAAGAATCTGAGCAA
                    ************************************************************

HsCD00021523        ATTGTCCTGATAGGATCAAAGACAAATGGAAAGTTCCTGATCCGAGCCAGAGACAACAAC
NM_003177.5         ATTGTCCTGATAGGATCAAAGACAAATGGAAAGTTCCTGATCCGAGCCAGAGACAACAAC
NM_001135052.2      ATTGTCCTGATAGGATCAAAGACAAATGGAAAGTTCCTGATCCGAGCCAGAGACAACAAC
NM_001174168.1      ATTGTCCTGATAGGATCAAAGACAAATGGAAAGTTCCTGATCCGAGCCAGAGACAACAAC
NM_001174167.1      ATTGTCCTGATAGGATCAAAGACAAATGGAAAGTTCCTGATCCGAGCCAGAGACAACAAC
                    ************************************************************

HsCD00021523        GGCTCCTACGCCCTGTGCCTGCTGCACGAAGGGAAGGTGCTGCACTATCGCATCGACAAA
NM_003177.5         GGCTCCTACGCCCTGTGCCTGCTGCACGAAGGGAAGGTGCTGCACTATCGCATCGACAAA
NM_001135052.2      GGCTCCTACGCCCTGTGCCTGCTGCACGAAGGGAAGGTGCTGCACTATCGCATCGACAAA
NM_001174168.1      GGCTCCTACGCCCTGTGCCTGCTGCACGAAGGGAAGGTGCTGCACTATCGCATCGACAAA
NM_001174167.1      GGCTCCTACGCCCTGTGCCTGCTGCACGAAGGGAAGGTGCTGCACTATCGCATCGACAAA
                    ************************************************************

HsCD00021523        GACAAGACAGGGAAGCTCTCCATCCCCGAGGGAAAGAAGTTCGACACGCTCTGGCAGCTA
NM_003177.5         GACAAGACAGGGAAGCTCTCCATCCCCGAGGGAAAGAAGTTCGACACGCTCTGGCAGCTA
NM_001135052.2      GACAAGACAGGGAAGCTCTCCATCCCCGAGGGAAAGAAGTTCGACACGCTCTGGCAGCTA
NM_001174168.1      GACAAGACAGGGAAGCTCTCCATCCCCGAGGGAAAGAAGTTCGACACGCTCTGGCAGCTA
NM_001174167.1      GACAAGACAGGGAAGCTCTCCATCCCCGAGGGAAAGAAGTTCGACACGCTCTGGCAGCTA
                    ************************************************************

HsCD00021523        GTCGAGCATTATTCTTATAAAGCAGATGGTTTGTTAAGAGTTCTTACTGTCCCATGTCAA
NM_003177.5         GTCGAGCATTATTCTTATAAAGCAGATGGTTTGTTAAGAGTTCTTACTGTCCCATGTCAA
NM_001135052.2      GTCGAGCATTATTCTTATAAAGCAGATGGTTTGTTAAGAGTTCTTACTGTCCCATGTCAA
NM_001174168.1      GTCGAGCATTATTCTTATAAAGCAGATGGTTTGTTAAGAGTTCTTACTGTCCCATGTCAA
NM_001174167.1      GTCGAGCATTATTCTTATAAAGCAGATGGTTTGTTAAGAGTTCTTACTGTCCCATGTCAA
                    ************************************************************

HsCD00021523        AAAATCGGCACACAGGGAAATGTTAATTTTGGAGGCCGTCCACAACTTCCAGGTTCCCAT
NM_003177.5         AAAATCGGCACACAGGGAAATGTTAATTTTGGAGGCCGTCCACAACTTCCAGGTTCCCAT
NM_001135052.2      AAAATCGGCACACAGGGAAATGTTAATTTTGGAGGCCGTCCACAACTTCCAGGTTCCCAT
NM_001174168.1      AAAATCGGCACACAGGGAAATGTTAATTTTGGAGGCCGTCCACAACTTCCAGGTTCCCAT
NM_001174167.1      AAAATCGGCACACAGGGAAATGTTAATTTTGGAGGCCGTCCACAACTTCCAGGTTCCCAT
                    ************************************************************

HsCD00021523        CCTGCGACTTGGTCAGCGGGTGGAATAATCTCAAGAATCAAATCATACTCCTTCCCAAAG
NM_003177.5         CCTGCGACTTGGTCAGCGGGTGGAATAATCTCAAGAATCAAATCATACTCCTTCCCAAAG
NM_001135052.2      CCTGCGTCCT--------------------------------------------------
NM_001174168.1      CCTGCGTCCT--------------------------------------------------
NM_001174167.1      CCTGCGACTTGGTCAGCGGGTGGAATAATCTCAAGAATCAAATCATACTCCTTCCCAAAG
                    ******:* *                                                  

HsCD00021523        CCTGGCCACAGAAAGTCCTCCCCTGCCCAAGGGAACCGGCAAGAGAGTACTGTGTCATTC
NM_003177.5         CCTGGCCACAGAAAGTCCTCCCCTGCCCAAGGGAACCGGCAAGAGAGTACTGTGTCATTC
NM_001135052.2      -------------------CCCCTGCCCAAGGGAACCGGCAAGAGAGTACTGTGTCATTC
NM_001174168.1      -------------------CCCCTGCCCAAGGGAACCGGCAAGAGAGTACTGTGTCATTC
NM_001174167.1      CCTGGCCACAGAAAGTCCTCCCCTGCCCAAGGGAACCGGCAAGAGAGTACTGTGTCATTC
                                       *****************************************

HsCD00021523        AATCCGTATGAGCCAGAACTTGCACCCTGGGCTGCAGACAAAGGCCCCCAGAGAGAAGCC
NM_003177.5         AATCCGTATGAGCCAGAACTTGCACCCTGGGCTGCAGACAAAGGCCCCCAGAGAGAAGCC
NM_001135052.2      AATCCGTATGAGCCAGAACTTGCACCCTGGGCTGCAGACAAAGGCCCCCAGAGAGAAGCC
NM_001174168.1      AATCCGTATGAGCCAGAACTTGCACCCTGGGCTGCAGACAAAGGCCCCCAGAGAGAAGCC
NM_001174167.1      AATCCGTATGAGCCAGAACTTGCACCCTGGGCTGCAGACAAAGGCCCCCAGAGAGAAGCC
                    ************************************************************

HsCD00021523        CTACCCATGGACACAGAGGTGTACGAGAGCCCCTACGCGGACCCTGAGGAGATCAGGCCC
NM_003177.5         CTACCCATGGACACAGAGGTGTACGAGAGCCCCTACGCGGACCCCGAGGAGATCAGGCCC
NM_001135052.2      CTACCCATGGACACAGAGGTGTACGAGAGCCCCTACGCGGACCCCGAGGAGATCAGGCCC
NM_001174168.1      CTACCCATGGACACAGAGGTGTACGAGAGCCCCTACGCGGACCCCGAGGAGATCAGGCCC
NM_001174167.1      CTACCCATGGACACAGAGGTGTACGAGAGCCCCTACGCGGACCCCGAGGAGATCAGGCCC
                    ******************************************** ***************

HsCD00021523        AAGGAGGTTTACCTGGACCGAAAGCTGCTGACGCTGGAAGACAAAGAACTGGGCTCTGGT
NM_003177.5         AAGGAGGTTTACCTGGACCGAAAGCTGCTGACGCTGGAAGACAAAGAACTGGGCTCTGGT
NM_001135052.2      AAGGAGGTTTACCTGGACCGAAAGCTGCTGACGCTGGAAGACAAAGAACTGGGCTCTGGT
NM_001174168.1      AAGGAGGTTTACCTGGACCGAAAGCTGCTGACGCTGGAAGACAAAGAACTGGGCTCTGGT
NM_001174167.1      AAGGAGGTTTACCTGGACCGAAAGCTGCTGACGCTGGAAGACAAAGAACTGGGCTCTGGT
                    ************************************************************

HsCD00021523        AATTTTGGAACTGTGAAAAAGGGCTACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCT
NM_003177.5         AATTTTGGAACTGTGAAAAAGGGCTACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCT
NM_001135052.2      AATTTTGGAACTGTGAAAAAGGGCTACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCT
NM_001174168.1      AATTTTGGAACTGTGAAAAAGGGCTACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCT
NM_001174167.1      AATTTTGGAACTGTGAAAAAGGGCTACTACCAAATGAAAAAAGTTGTGAAAACCGTGGCT
                    ************************************************************

HsCD00021523        GTGAAAATACTGAAAAACGAGGCCAATGACCCCGCTCTTAAAGATGAGTTATTAGCAGAA
NM_003177.5         GTGAAAATACTGAAAAACGAGGCCAATGACCCCGCTCTTAAAGATGAGTTATTAGCAGAA
NM_001135052.2      GTGAAAATACTGAAAAACGAGGCCAATGACCCCGCTCTTAAAGATGAGTTATTAGCAGAA
NM_001174168.1      GTGAAAATACTGAAAAACGAGGCCAATGACCCCGCTCTTAAAGATGAGTTATTAGCAGAA
NM_001174167.1      GTGAAAATACTGAAAAACGAGGCCAATGACCCCGCTCTTAAAGATGAGTTATTAGCAGAA
                    ************************************************************

HsCD00021523        GCAAATGTCATGCAGCAGCTGGACAACCCGTACATCGTGCGCATGATCGGGATATGCGAG
NM_003177.5         GCAAATGTCATGCAGCAGCTGGACAACCCGTACATCGTGCGGATGATCGGGATATGCGAG
NM_001135052.2      GCAAATGTCATGCAGCAGCTGGACAACCCGTACATCGTGCGGATGATCGGGATATGCGAG
NM_001174168.1      GCAAATGTCATGCAGCAGCTGGACAACCCGTACATCGTGCGGATGATCGGGATATGCGAG
NM_001174167.1      GCAAATGTCATGCAGCAGCTGGACAACCCGTACATCGTGCGGATGATCGGGATATGCGAG
                    ***************************************** ******************

HsCD00021523        GCCGAGTCCTGGATGCTAGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTG
NM_003177.5         GCCGAGTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTG
NM_001135052.2      GCCGAGTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTG
NM_001174168.1      GCCGAGTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTG
NM_001174167.1      GCCGAGTCCTGGATGCTGGTTATGGAGATGGCAGAACTTGGTCCCCTCAATAAGTATTTG
                    *****************.******************************************

HsCD00021523        CAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATG
NM_003177.5         CAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATG
NM_001135052.2      CAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATG
NM_001174168.1      CAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATG
NM_001174167.1      CAGCAGAACAGACATGTCAAGGATAAGAACATCATAGAACTGGTTCATCAGGTTTCCATG
                    ************************************************************

HsCD00021523        GGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTG
NM_003177.5         GGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTG
NM_001135052.2      GGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTG
NM_001174168.1      GGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTG
NM_001174167.1      GGCATGAAGTACTTGGAGGAGAGCAATTTTGTGCACAGAGATCTGGCTGCAAGAAATGTG
                    ************************************************************

HsCD00021523        TTGCTAGTTACCCAACATTATGCCAAGATCAGTGATTTCGGACTCTCCAAAGCACTGCGT
NM_003177.5         TTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGT
NM_001135052.2      TTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGT
NM_001174168.1      TTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGT
NM_001174167.1      TTGCTAGTTACCCAACATTACGCCAAGATCAGTGATTTCGGACTTTCCAAAGCACTGCGT
                    ******************** *********************** ***************

HsCD00021523        GCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCT
NM_003177.5         GCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCT
NM_001135052.2      GCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCT
NM_001174168.1      GCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCT
NM_001174167.1      GCTGATGAAAACTACTACAAGGCCCAGACCCATGGAAAGTGGCCTGTCAAGTGGTACGCT
                    ************************************************************

HsCD00021523        CCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTG
NM_003177.5         CCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTG
NM_001135052.2      CCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTG
NM_001174168.1      CCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTG
NM_001174167.1      CCGGAATGCATCAACTACTACAAGTTCTCCAGCAAAAGCGATGTCTGGAGCTTTGGAGTG
                    ************************************************************

HsCD00021523        TTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGAAAGGAAGTGAA
NM_003177.5         TTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGAAAGGAAGTGAA
NM_001135052.2      TTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGAAAGGAAGTGAA
NM_001174168.1      TTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGAAAGGAAGTGAA
NM_001174167.1      TTGATGTGGGAAGCATTCTCCTATGGGCAGAAGCCATATCGAGGGATGAAAGGAAGTGAA
                    ************************************************************

HsCD00021523        GTCACCGCTATGTTAGAGAAAGGAGAGCGGATGGGGTGCCCTGCAGGGTGTCCAAGAGAG
NM_003177.5         GTCACCGCTATGTTAGAGAAAGGAGAGCGGATGGGGTGCCCTGCAGGGTGTCCAAGAGAG
NM_001135052.2      GTCACCGCTATGTTAGAGAAAGGAGAGCGGATGGGGTGCCCTGCAGGGTGTCCAAGAGAG
NM_001174168.1      GTCACCGCTATGTTAGAGAAAGGAGAGCGGATGGGGTGCCCTGCAGGGTGTCCAAGAGAG
NM_001174167.1      GTCACCGCTATGTTAGAGAAAGGAGAGCGGATGGGGTGCCCTGCAGGGTGTCCAAGAGAG
                    ************************************************************

HsCD00021523        ATGTACGATCTCATGAATCTGTGCTGGACATACGATGTGGAAAACAGGCCCGGATTCGCA
NM_003177.5         ATGTACGATCTCATGAATCTGTGCTGGACATACGATGTGGAAAACAGGCCCGGATTCGCA
NM_001135052.2      ATGTACGATCTCATGAATCTGTGCTGGACATACGATGTGGAAAACAGGCCCGGATTCGCA
NM_001174168.1      ATGTACGATCTCATGAATCTGTGCTGGACATACGATGTGGAAAACAGGCCCGGATTCGCA
NM_001174167.1      ATGTACGATCTCATGAATCTGTGCTGGACATACGATGTGGAAAACAGGCCCGGATTCGCA
                    ************************************************************

HsCD00021523        GCAGTGGAACTGCGGCTGCGCAATTACTACTATGACGTGGTGAACTTG
NM_003177.5         GCAGTGGAACTGCGGCTGCGCAATTACTACTATGACGTGGTGAACTAA
NM_001135052.2      GCAGTGGAACTGCGGCTGCGCAATTACTACTATGACGTGGTGAACTAA
NM_001174168.1      GCAGTGGAACTGCGGCTGCGCAATTACTACTATGACGTGGTGAACTAA
NM_001174167.1      GCAGTGGAACTGCGGCTGCGCAATTACTACTATGACGTGGTGAACTAA
                    **********************************************:.

Pathways

NCI : Alpha-synuclein signaling
NCI : Atypical NF-kappaB pathway
NCI : BCR signaling pathway
NCI : Class I PI3K signaling events
NCI : FAS (CD95) signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IL2-mediated signaling events
NCI : Osteopontin-mediated events
NCI : Thromboxane A2 receptor signaling
Panther : B cell activation
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : FCERI mediated Ca+2 mobilization
Reactome : FCERI mediated MAPK activation
Reactome : FCGR activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GPVI-mediated activation cascade
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Interleukin-2 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Role of phospholipids in phagocytosis
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by the B Cell Receptor (BCR)
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway

Clone

Cloning Information : 203942
HIP Master Clone ID : 178287
Original Clone ID : FLH203942.01F

Organism


TAX_ID : 9606
Species Specific ID: 6850

Genome

Chromosome : 9
Map Location : 9q22
Ensembl : ENSG00000165025

Reagents

Labome : Syk-antibody