DNASU Plasmid Repository • 480.965.5697 | Email

KIT (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  KIT
Gene Name:  v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH204094.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021552

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2931nts         Open reading frame : 1 to 2931
Reference Sequence Alignment

ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
TCTGTGTACTCAACGTGGAAAAGAGAAAACAGTCAGACTAAACTACAGGAGAAATATAAT
AGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCAGCG
AGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCAAAT
GTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATAAAC
ACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCATTC
CCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGGGAA
GATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTAACG
AGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTCAAT
GCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGACAGG
CTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGATTGG
TATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTGCAG
ACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGATTCT
AGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAGACT
TCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCACACC
CTGTTCACTCCTTTGCTGATTGGTTTTGTAATCGTAGCTGGCATGATGTGCATTATTGTG
ATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTTGTT
GAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATCAC
AAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCTTTC
GGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACTGTC
GCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCTGAA
CTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCCTGC
ACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTGAAT
TTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAAGCT
GCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAATGAG
TACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGGAGA
TCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGATGAC
GAGTTGGCCATAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGCATG
GCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTCCTT
ACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAATGAT
TCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACATGAAAGC
ATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTTTGG
GAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTCTAC
AAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATGTAT
GACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAAATT
GTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTAGCA
AACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCTGTC
GGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3007
Start on reference sequence 77
Mutations:
None
Discrepancy:
c1587t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : KIT
Symbol Nomenclature : KIT
SYNONYM : C-Kit; CD117; PBT; SCFR
Designation : mast/stem cell growth factor receptor Kit|p145 c-kit|piebald trait protein|proto-oncogene c-Kit|proto-oncogene tyrosine-protein kinase Kit|soluble KIT variant 1|tyrosine-protein kinase Kit|v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene-like protein
Full Nomenclature : v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
GENEID : 3815
HGNC : 6342
MIM : 164920
Vega : OTTHUMG00000128713
Target GenBank: BC071593

 

Reference Sequence Alignment

  

HsCD00021552        ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
XM_005265742.1      ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
XM_005265740.1      ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
NM_000222.2         ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
XM_005265741.1      ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
NM_001093772.1      ATGAGAGGCGCTCGCGGCGCCTGGGATTTTCTCTGCGTTCTGCTCCTACTGCTTCGCGTC
                    ************************************************************

HsCD00021552        CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
XM_005265742.1      CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
XM_005265740.1      CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
NM_000222.2         CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
XM_005265741.1      CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
NM_001093772.1      CAGACAGGCTCTTCTCAACCATCTGTGAGTCCAGGGGAACCGTCTCCACCATCCATCCAT
                    ************************************************************

HsCD00021552        CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
XM_005265742.1      CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
XM_005265740.1      CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
NM_000222.2         CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
XM_005265741.1      CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
NM_001093772.1      CCAGGAAAATCAGACTTAATAGTCCGCGTGGGCGACGAGATTAGGCTGTTATGCACTGAT
                    ************************************************************

HsCD00021552        CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
XM_005265742.1      CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
XM_005265740.1      CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
NM_000222.2         CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
XM_005265741.1      CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
NM_001093772.1      CCGGGCTTTGTCAAATGGACTTTTGAGATCCTGGATGAAACGAATGAGAATAAGCAGAAT
                    ************************************************************

HsCD00021552        GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
XM_005265742.1      GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
XM_005265740.1      GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
NM_000222.2         GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
XM_005265741.1      GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
NM_001093772.1      GAATGGATCACGGAAAAGGCAGAAGCCACCAACACCGGCAAATACACGTGCACCAACAAA
                    ************************************************************

HsCD00021552        CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
XM_005265742.1      CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
XM_005265740.1      CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
NM_000222.2         CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
XM_005265741.1      CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
NM_001093772.1      CACGGCTTAAGCAATTCCATTTATGTGTTTGTTAGAGATCCTGCCAAGCTTTTCCTTGTT
                    ************************************************************

HsCD00021552        GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
XM_005265742.1      GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
XM_005265740.1      GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
NM_000222.2         GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
XM_005265741.1      GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
NM_001093772.1      GACCGCTCCTTGTATGGGAAAGAAGACAACGACACGCTGGTCCGCTGTCCTCTCACAGAC
                    ************************************************************

HsCD00021552        CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
XM_005265742.1      CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
XM_005265740.1      CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
NM_000222.2         CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
XM_005265741.1      CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
NM_001093772.1      CCAGAAGTGACCAATTATTCCCTCAAGGGGTGCCAGGGGAAGCCTCTTCCCAAGGACTTG
                    ************************************************************

HsCD00021552        AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
XM_005265742.1      AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
XM_005265740.1      AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
NM_000222.2         AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
XM_005265741.1      AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
NM_001093772.1      AGGTTTATTCCTGACCCCAAGGCGGGCATCATGATCAAAAGTGTGAAACGCGCCTACCAT
                    ************************************************************

HsCD00021552        CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
XM_005265742.1      CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
XM_005265740.1      CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
NM_000222.2         CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
XM_005265741.1      CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
NM_001093772.1      CGGCTCTGTCTGCATTGTTCTGTGGACCAGGAGGGCAAGTCAGTGCTGTCGGAAAAATTC
                    ************************************************************

HsCD00021552        ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
XM_005265742.1      ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
XM_005265740.1      ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
NM_000222.2         ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
XM_005265741.1      ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
NM_001093772.1      ATCCTGAAAGTGAGGCCAGCCTTCAAAGCTGTGCCTGTTGTGTCTGTGTCCAAAGCAAGC
                    ************************************************************

HsCD00021552        TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
XM_005265742.1      TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
XM_005265740.1      TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
NM_000222.2         TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
XM_005265741.1      TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
NM_001093772.1      TATCTTCTTAGGGAAGGGGAAGAATTCACAGTGACGTGCACAATAAAAGATGTGTCTAGT
                    ************************************************************

HsCD00021552        TCTGTGTACTCAACGTGGAAAAGAGAAAACAG---TCAGACTAAACTACAGGAGAAATAT
XM_005265742.1      TCTGTGTACTCAACGTGGAAAAGAGAAAACAGTCAGCAGACTAAACTACAGGAGAAATAT
XM_005265740.1      TCTGTGTACTCAACGTGGAAAAGAGAAAACAGTCAGCAGACTAAACTACAGGAGAAATAT
NM_000222.2         TCTGTGTACTCAACGTGGAAAAGAGAAAACAG---TCAGACTAAACTACAGGAGAAATAT
XM_005265741.1      TCTGTGTACTCAACGTGGAAAAGAGAAAACAGTCAGCAGACTAAACTACAGGAGAAATAT
NM_001093772.1      TCTGTGTACTCAACGTGGAAAAGAGAAAACAG---TCAGACTAAACTACAGGAGAAATAT
                    ********************************    ************************

HsCD00021552        AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
XM_005265742.1      AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
XM_005265740.1      AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
NM_000222.2         AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
XM_005265741.1      AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
NM_001093772.1      AATAGCTGGCATCACGGTGACTTCAATTATGAACGTCAGGCAACGTTGACTATCAGTTCA
                    ************************************************************

HsCD00021552        GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
XM_005265742.1      GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
XM_005265740.1      GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
NM_000222.2         GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
XM_005265741.1      GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
NM_001093772.1      GCGAGAGTTAATGATTCTGGAGTGTTCATGTGTTATGCCAATAATACTTTTGGATCAGCA
                    ************************************************************

HsCD00021552        AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
XM_005265742.1      AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
XM_005265740.1      AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
NM_000222.2         AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
XM_005265741.1      AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
NM_001093772.1      AATGTCACAACAACCTTGGAAGTAGTAGATAAAGGATTCATTAATATCTTCCCCATGATA
                    ************************************************************

HsCD00021552        AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
XM_005265742.1      AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
XM_005265740.1      AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
NM_000222.2         AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
XM_005265741.1      AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
NM_001093772.1      AACACTACAGTATTTGTAAACGATGGAGAAAATGTAGATTTGATTGTTGAATATGAAGCA
                    ************************************************************

HsCD00021552        TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
XM_005265742.1      TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
XM_005265740.1      TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
NM_000222.2         TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
XM_005265741.1      TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
NM_001093772.1      TTCCCCAAACCTGAACACCAGCAGTGGATCTATATGAACAGAACCTTCACTGATAAATGG
                    ************************************************************

HsCD00021552        GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
XM_005265742.1      GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
XM_005265740.1      GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
NM_000222.2         GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
XM_005265741.1      GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
NM_001093772.1      GAAGATTATCCCAAGTCTGAGAATGAAAGTAATATCAGATACGTAAGTGAACTTCATCTA
                    ************************************************************

HsCD00021552        ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
XM_005265742.1      ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
XM_005265740.1      ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
NM_000222.2         ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
XM_005265741.1      ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
NM_001093772.1      ACGAGATTAAAAGGCACCGAAGGAGGCACTTACACATTCCTAGTGTCCAATTCTGACGTC
                    ************************************************************

HsCD00021552        AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
XM_005265742.1      AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
XM_005265740.1      AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
NM_000222.2         AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
XM_005265741.1      AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
NM_001093772.1      AATGCTGCCATAGCATTTAATGTTTATGTGAATACAAAACCAGAAATCCTGACTTACGAC
                    ************************************************************

HsCD00021552        AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
XM_005265742.1      AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
XM_005265740.1      AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
NM_000222.2         AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
XM_005265741.1      AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
NM_001093772.1      AGGCTCGTGAATGGCATGCTCCAATGTGTGGCAGCAGGATTCCCAGAGCCCACAATAGAT
                    ************************************************************

HsCD00021552        TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
XM_005265742.1      TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
XM_005265740.1      TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
NM_000222.2         TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
XM_005265741.1      TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
NM_001093772.1      TGGTATTTTTGTCCAGGAACTGAGCAGAGATGCTCTGCTTCTGTACTGCCAGTGGATGTG
                    ************************************************************

HsCD00021552        CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
XM_005265742.1      CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
XM_005265740.1      CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
NM_000222.2         CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
XM_005265741.1      CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
NM_001093772.1      CAGACACTAAACTCATCTGGGCCACCGTTTGGAAAGCTAGTGGTTCAGAGTTCTATAGAT
                    ************************************************************

HsCD00021552        TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
XM_005265742.1      TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
XM_005265740.1      TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
NM_000222.2         TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
XM_005265741.1      TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
NM_001093772.1      TCTAGTGCATTCAAGCACAATGGCACGGTTGAATGTAAGGCTTACAACGATGTGGGCAAG
                    ************************************************************

HsCD00021552        ACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCAC
XM_005265742.1      ACTTCTGCCTATTTTAACTTTGCATTTAAAG------------AGCAAATCCATCCCCAC
XM_005265740.1      ACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCAC
NM_000222.2         ACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCAC
XM_005265741.1      ACTTCTGCCTATTTTAACTTTGCATTTAAAGGTAACAACAAAGAGCAAATCCATCCCCAC
NM_001093772.1      ACTTCTGCCTATTTTAACTTTGCATTTAAAG------------AGCAAATCCATCCCCAC
                    *******************************            *****************

HsCD00021552        ACCCTGTTCACTCCTTTGCTGATTGGTTTTGTAATCGTAGCTGGCATGATGTGCATTATT
XM_005265742.1      ACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATT
XM_005265740.1      ACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATT
NM_000222.2         ACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATT
XM_005265741.1      ACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATT
NM_001093772.1      ACCCTGTTCACTCCTTTGCTGATTGGTTTCGTAATCGTAGCTGGCATGATGTGCATTATT
                    ***************************** ******************************

HsCD00021552        GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
XM_005265742.1      GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
XM_005265740.1      GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
NM_000222.2         GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
XM_005265741.1      GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
NM_001093772.1      GTGATGATTCTGACCTACAAATATTTACAGAAACCCATGTATGAAGTACAGTGGAAGGTT
                    ************************************************************

HsCD00021552        GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
XM_005265742.1      GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
XM_005265740.1      GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
NM_000222.2         GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
XM_005265741.1      GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
NM_001093772.1      GTTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGAT
                    ************************************************************

HsCD00021552        CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
XM_005265742.1      CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
XM_005265740.1      CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
NM_000222.2         CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
XM_005265741.1      CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
NM_001093772.1      CACAAATGGGAGTTTCCCAGAAACAGGCTGAGTTTTGGGAAAACCCTGGGTGCTGGAGCT
                    ************************************************************

HsCD00021552        TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
XM_005265742.1      TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
XM_005265740.1      TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
NM_000222.2         TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
XM_005265741.1      TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
NM_001093772.1      TTCGGGAAGGTTGTTGAGGCAACTGCTTATGGCTTAATTAAGTCAGATGCGGCCATGACT
                    ************************************************************

HsCD00021552        GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
XM_005265742.1      GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
XM_005265740.1      GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
NM_000222.2         GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
XM_005265741.1      GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
NM_001093772.1      GTCGCTGTAAAGATGCTCAAGCCGAGTGCCCATTTGACAGAACGGGAAGCCCTCATGTCT
                    ************************************************************

HsCD00021552        GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
XM_005265742.1      GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
XM_005265740.1      GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
NM_000222.2         GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
XM_005265741.1      GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
NM_001093772.1      GAACTCAAAGTCCTGAGTTACCTTGGTAATCACATGAATATTGTGAATCTACTTGGAGCC
                    ************************************************************

HsCD00021552        TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
XM_005265742.1      TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
XM_005265740.1      TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
NM_000222.2         TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
XM_005265741.1      TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
NM_001093772.1      TGCACCATTGGAGGGCCCACCCTGGTCATTACAGAATATTGTTGCTATGGTGATCTTTTG
                    ************************************************************

HsCD00021552        AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
XM_005265742.1      AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
XM_005265740.1      AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
NM_000222.2         AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
XM_005265741.1      AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
NM_001093772.1      AATTTTTTGAGAAGAAAACGTGATTCATTTATTTGTTCAAAGCAGGAAGATCATGCAGAA
                    ************************************************************

HsCD00021552        GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAAT
XM_005265742.1      GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAAT
XM_005265740.1      GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAAT
NM_000222.2         GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAAT
XM_005265741.1      GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCG---ATAGTACTAAT
NM_001093772.1      GCTGCACTTTATAAGAATCTTCTGCATTCAAAGGAGTCTTCCTGCAGCGATAGTACTAAT
                    *********************************************.   ***********

HsCD00021552        GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
XM_005265742.1      GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
XM_005265740.1      GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
NM_000222.2         GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
XM_005265741.1      GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
NM_001093772.1      GAGTACATGGACATGAAACCTGGAGTTTCTTATGTTGTCCCAACCAAGGCCGACAAAAGG
                    ************************************************************

HsCD00021552        AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
XM_005265742.1      AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
XM_005265740.1      AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
NM_000222.2         AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
XM_005265741.1      AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
NM_001093772.1      AGATCTGTGAGAATAGGCTCATACATAGAAAGAGATGTGACTCCCGCCATCATGGAGGAT
                    ************************************************************

HsCD00021552        GACGAGTTGGCCATAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
XM_005265742.1      GACGAGTTGGCCCTAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
XM_005265740.1      GACGAGTTGGCCCTAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
NM_000222.2         GACGAGTTGGCCCTAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
XM_005265741.1      GACGAGTTGGCCCTAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
NM_001093772.1      GACGAGTTGGCCCTAGACTTAGAAGACTTGCTGAGCTTTTCTTACCAGGTGGCAAAGGGC
                    ************.***********************************************

HsCD00021552        ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
XM_005265742.1      ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
XM_005265740.1      ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
NM_000222.2         ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
XM_005265741.1      ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
NM_001093772.1      ATGGCTTTCCTCGCCTCCAAGAATTGTATTCACAGAGACTTGGCAGCCAGAAATATCCTC
                    ************************************************************

HsCD00021552        CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
XM_005265742.1      CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
XM_005265740.1      CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
NM_000222.2         CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
XM_005265741.1      CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
NM_001093772.1      CTTACTCATGGTCGGATCACAAAGATTTGTGATTTTGGTCTAGCCAGAGACATCAAGAAT
                    ************************************************************

HsCD00021552        GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACATGAA
XM_005265742.1      GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACCTGAA
XM_005265740.1      GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACCTGAA
NM_000222.2         GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACCTGAA
XM_005265741.1      GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACCTGAA
NM_001093772.1      GATTCTAATTATGTGGTTAAAGGAAACGCTCGACTACCTGTGAAGTGGATGGCACCTGAA
                    *******************************************************.****

HsCD00021552        AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
XM_005265742.1      AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
XM_005265740.1      AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
NM_000222.2         AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
XM_005265741.1      AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
NM_001093772.1      AGCATTTTCAACTGTGTATACACGTTTGAAAGTGACGTCTGGTCCTATGGGATTTTTCTT
                    ************************************************************

HsCD00021552        TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
XM_005265742.1      TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
XM_005265740.1      TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
NM_000222.2         TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
XM_005265741.1      TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
NM_001093772.1      TGGGAGCTGTTCTCTTTAGGAAGCAGCCCCTATCCTGGAATGCCGGTCGATTCTAAGTTC
                    ************************************************************

HsCD00021552        TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
XM_005265742.1      TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
XM_005265740.1      TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
NM_000222.2         TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
XM_005265741.1      TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
NM_001093772.1      TACAAGATGATCAAGGAAGGCTTCCGGATGCTCAGCCCTGAACACGCACCTGCTGAAATG
                    ************************************************************

HsCD00021552        TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
XM_005265742.1      TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
XM_005265740.1      TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
NM_000222.2         TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
XM_005265741.1      TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
NM_001093772.1      TATGACATAATGAAGACTTGCTGGGATGCAGATCCCCTAAAAAGACCAACATTCAAGCAA
                    ************************************************************

HsCD00021552        ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
XM_005265742.1      ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
XM_005265740.1      ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
NM_000222.2         ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
XM_005265741.1      ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
NM_001093772.1      ATTGTTCAGCTAATTGAGAAGCAGATTTCAGAGAGCACCAATCATATTTACTCCAACTTA
                    ************************************************************

HsCD00021552        GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
XM_005265742.1      GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
XM_005265740.1      GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
NM_000222.2         GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
XM_005265741.1      GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
NM_001093772.1      GCAAACTGCAGCCCCAACCGACAGAAGCCCGTGGTAGACCATTCTGTGCGGATCAATTCT
                    ************************************************************

HsCD00021552        GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTTG
XM_005265742.1      GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTGA
XM_005265740.1      GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTGA
NM_000222.2         GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTGA
XM_005265741.1      GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTGA
NM_001093772.1      GTCGGCAGCACCGCTTCCTCCTCCCAGCCTCTGCTTGTGCACGACGATGTCTGA
                    **************************************************** .

Pathways

NCI : C-MYB transcription factor network
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
Reactome : Adaptive Immune System
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Immune System
Reactome : Innate Immune System
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Regulation of KIT signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
WikiPathway : Epithelium TarBase
WikiPathway : Kit receptor signaling pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : Muscle cell TarBase

Clone

Cloning Information : 204094
HIP Master Clone ID : 178516
Original Clone ID : FLH204094.01F

Organism


TAX_ID : 9606
Species Specific ID: 3815

Genome

Chromosome : 4
Map Location : 4q12
Ensembl : ENSG00000157404

Reagents

Labome : C-kit-antibody