DNASU Plasmid Repository • 480.965.5697 | Email

TBK1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TBK1
Gene Name:  TANK-binding kinase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH159321.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021636

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2190nts         Open reading frame : 1 to 2190
Reference Sequence Alignment

ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
GCTCATAAGATTTATATACATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
GTAGTAAGCCGGGAACCTCTGGATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
GAGATTTACTATCAGTTCAAAAAAGACCAAGCAGAACGTAGATTAGCTTATAATGAAGAA
CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
GGTGGCCTTCGCAACGTTGACTGTCTTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2294
Start on reference sequence 105
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TBK1
Symbol Nomenclature : TBK1
SYNONYM : NAK; T2K
Designation : NF-kB-activating kinase|NF-kappa-B-activating kinase|serine/threonine-protein kinase TBK1
Full Nomenclature : TANK-binding kinase 1
GENEID : 29110
HGNC : 11584
MIM : 604834
Vega : OTTHUMG00000168796
Target GenBank: BC034950

 

Reference Sequence Alignment

  

HsCD00021636        ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
XM_005268810.1      ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
XM_005268809.1      ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
NM_013254.3         ATGCAGAGCACTTCTAATCATCTGTGGCTTTTATCTGATATTTTAGGCCAAGGAGCTACT
                    ************************************************************

HsCD00021636        GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
XM_005268810.1      GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
XM_005268809.1      GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
NM_013254.3         GCAAATGTCTTTCGTGGAAGACATAAGAAAACTGGTGATTTATTTGCTATCAAAGTATTT
                    ************************************************************

HsCD00021636        AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
XM_005268810.1      AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
XM_005268809.1      AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
NM_013254.3         AATAACATAAGCTTCCTTCGTCCAGTGGATGTTCAAATGAGAGAATTTGAAGTGTTGAAA
                    ************************************************************

HsCD00021636        AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
XM_005268810.1      AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
XM_005268809.1      AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
NM_013254.3         AAACTCAATCACAAAAATATTGTCAAATTATTTGCTATTGAAGAGGAGACAACAACAAGA
                    ************************************************************

HsCD00021636        CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
XM_005268810.1      CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
XM_005268809.1      CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
NM_013254.3         CATAAAGTACTTATTATGGAATTTTGTCCATGTGGGAGTTTATACACTGTTTTAGAAGAA
                    ************************************************************

HsCD00021636        CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
XM_005268810.1      CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
XM_005268809.1      CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
NM_013254.3         CCTTCTAATGCCTATGGACTACCAGAATCTGAATTCTTAATTGTTTTGCGAGATGTGGTG
                    ************************************************************

HsCD00021636        GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
XM_005268810.1      GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
XM_005268809.1      GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
NM_013254.3         GGTGGAATGAATCATCTACGAGAGAATGGTATAGTGCACCGTGATATCAAGCCAGGAAAT
                    ************************************************************

HsCD00021636        ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
XM_005268810.1      ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
XM_005268809.1      ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
NM_013254.3         ATCATGCGTGTTATAGGGGAAGATGGACAGTCTGTGTACAAACTCACAGATTTTGGTGCA
                    ************************************************************

HsCD00021636        GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
XM_005268810.1      GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
XM_005268809.1      GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
NM_013254.3         GCTAGAGAATTAGAAGATGATGAGCAGTTTGTTTCTCTGTATGGCACAGAAGAATATTTG
                    ************************************************************

HsCD00021636        CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
XM_005268810.1      CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
XM_005268809.1      CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
NM_013254.3         CACCCTGATATGTATGAGAGAGCAGTGCTAAGAAAAGATCATCAGAAGAAATATGGAGCA
                    ************************************************************

HsCD00021636        ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
XM_005268810.1      ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
XM_005268809.1      ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
NM_013254.3         ACAGTTGATCTTTGGAGCATTGGGGTAACATTTTACCATGCAGCTACTGGATCACTGCCA
                    ************************************************************

HsCD00021636        TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
XM_005268810.1      TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
XM_005268809.1      TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
NM_013254.3         TTTAGACCCTTTGAAGGGCCTCGTAGGAATAAAGAAGTGATGTATAAAATAATTACAGGA
                    ************************************************************

HsCD00021636        AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
XM_005268810.1      AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
XM_005268809.1      AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
NM_013254.3         AAGCCTTCTGGTGCAATATCTGGAGTACAGAAAGCAGAAAATGGACCAATTGACTGGAGT
                    ************************************************************

HsCD00021636        GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
XM_005268810.1      GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
XM_005268809.1      GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
NM_013254.3         GGAGACATGCCTGTTTCTTGCAGTCTTTCTCGGGGTCTTCAGGTTCTACTTACCCCTGTT
                    ************************************************************

HsCD00021636        CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
XM_005268810.1      CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
XM_005268809.1      CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
NM_013254.3         CTTGCAAACATCCTTGAAGCAGATCAGGAAAAGTGTTGGGGTTTTGACCAGTTTTTTGCA
                    ************************************************************

HsCD00021636        GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
XM_005268810.1      GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
XM_005268809.1      GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
NM_013254.3         GAAACTAGTGATATACTTCACCGAATGGTAATTCATGTTTTTTCGCTACAACAAATGACA
                    ************************************************************

HsCD00021636        GCTCATAAGATTTATATACATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
XM_005268810.1      GCTCATAAGATTTATATTCATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
XM_005268809.1      GCTCATAAGATTTATATTCATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
NM_013254.3         GCTCATAAGATTTATATTCATAGCTATAATACTGCTACTATATTTCATGAACTGGTATAT
                    *****************:******************************************

HsCD00021636        AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
XM_005268810.1      AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
XM_005268809.1      AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
NM_013254.3         AAACAAACCAAAATTATTTCTTCAAATCAAGAACTTATCTACGAAGGGCGACGCTTAGTC
                    ************************************************************

HsCD00021636        TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
XM_005268810.1      TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
XM_005268809.1      TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
NM_013254.3         TTAGAACCTGGAAGGCTGGCACAACATTTCCCTAAAACTACTGAGGAAAACCCTATATTT
                    ************************************************************

HsCD00021636        GTAGTAAGCCGGGAACCTCTGGATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
XM_005268810.1      GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
XM_005268809.1      GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
NM_013254.3         GTAGTAAGCCGGGAACCTCTGAATACCATAGGATTAATATATGAAAAAATTTCCCTCCCT
                    *********************.**************************************

HsCD00021636        AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
XM_005268810.1      AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
XM_005268809.1      AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
NM_013254.3         AAAGTACATCCACGTTATGATTTAGACGGGGATGCTAGCATGGCTAAGGCAATAACAGGG
                    ************************************************************

HsCD00021636        GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
XM_005268810.1      GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
XM_005268809.1      GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
NM_013254.3         GTTGTGTGTTATGCCTGCAGAATTGCCAGTACCTTACTGCTTTATCAGGAATTAATGCGA
                    ************************************************************

HsCD00021636        AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
XM_005268810.1      AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
XM_005268809.1      AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
NM_013254.3         AAGGGGATACGATGGCTGATTGAATTAATTAAAGATGATTACAATGAAACTGTTCACAAA
                    ************************************************************

HsCD00021636        AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
XM_005268810.1      AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
XM_005268809.1      AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
NM_013254.3         AAGACAGAAGTTGTGATCACATTGGATTTCTGTATCAGAAACATTGAAAAAACTGTGAAA
                    ************************************************************

HsCD00021636        GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
XM_005268810.1      GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
XM_005268809.1      GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
NM_013254.3         GTATATGAAAAGTTGATGAAGATCAACCTGGAAGCGGCAGAGTTAGGTGAAATTTCAGAC
                    ************************************************************

HsCD00021636        ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
XM_005268810.1      ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
XM_005268809.1      ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
NM_013254.3         ATACACACCAAATTGTTGAGACTTTCCAGTTCTCAGGGAACAATAGAAACCAGTCTTCAG
                    ************************************************************

HsCD00021636        GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
XM_005268810.1      GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
XM_005268809.1      GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
NM_013254.3         GATATCGACAGCAGATTATCTCCAGGTGGATCACTGGCAGACGCATGGGCACATCAAGAA
                    ************************************************************

HsCD00021636        GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
XM_005268810.1      GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
XM_005268809.1      GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
NM_013254.3         GGCACTCATCCGAAAGACAGAAATGTAGAAAAACTACAAGTCCTGTTAAATTGCATGACA
                    ************************************************************

HsCD00021636        GAGATTTACTATCAGTTCAAAAAAGACCAAGCAGAACGTAGATTAGCTTATAATGAAGAA
XM_005268810.1      GAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAACGTAGATTAGCTTATAATGAAGAA
XM_005268809.1      GAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAACGTAGATTAGCTTATAATGAAGAA
NM_013254.3         GAGATTTACTATCAGTTCAAAAAAGACAAAGCAGAACGTAGATTAGCTTATAATGAAGAA
                    ***************************.********************************

HsCD00021636        CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
XM_005268810.1      CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
XM_005268809.1      CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
NM_013254.3         CAAATCCACAAATTTGATAAGCAAAAACTGTATTACCATGCCACAAAAGCTATGACGCAC
                    ************************************************************

HsCD00021636        TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
XM_005268810.1      TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
XM_005268809.1      TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
NM_013254.3         TTTACAGATGAATGTGTTAAAAAGTATGAGGCATTTTTGAATAAGTCAGAAGAATGGATA
                    ************************************************************

HsCD00021636        AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
XM_005268810.1      AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
XM_005268809.1      AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
NM_013254.3         AGAAAGATGCTTCATCTTAGGAAACAGTTATTATCGCTGACTAATCAGTGTTTTGATATT
                    ************************************************************

HsCD00021636        GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
XM_005268810.1      GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
XM_005268809.1      GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
NM_013254.3         GAAGAAGAAGTATCAAAATATCAAGAATATACTAATGAGTTACAAGAAACTCTGCCTCAG
                    ************************************************************

HsCD00021636        AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
XM_005268810.1      AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
XM_005268809.1      AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
NM_013254.3         AAAATGTTTACAGCTTCCAGTGGAATCAAACATACCATGACCCCAATTTATCCAAGTTCT
                    ************************************************************

HsCD00021636        AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
XM_005268810.1      AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
XM_005268809.1      AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
NM_013254.3         AACACATTAGTAGAAATGACTCTTGGTATGAAGAAATTAAAGGAAGAGATGGAAGGGGTG
                    ************************************************************

HsCD00021636        GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
XM_005268810.1      GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
XM_005268809.1      GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
NM_013254.3         GTTAAAGAACTTGCTGAAAATAACCACATTTTAGAAAGGTTTGGCTCTTTAACCATGGAT
                    ************************************************************

HsCD00021636        GGTGGCCTTCGCAACGTTGACTGTCTTTTG
XM_005268810.1      GGTGGCCTTCGCAACGTTGACTGTCTTTAG
XM_005268809.1      GGTGGCCTTCGCAACGTTGACTGTCTTTAG
NM_013254.3         GGTGGCCTTCGCAACGTTGACTGTCTTTAG
                    ****************************:*

Pathways

Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : IRF3 mediated activation of type 1 IFN
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88-independent cascade
Reactome : Negative regulators of RIG-I/MDA5 signaling
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : Regulation of innate immune responses to cytosolic DNA
Reactome : STAT6-mediated induction of chemokines
Reactome : STING mediated induction of host immune responses
Reactome : TRAF3-dependent IRF activation pathway
Reactome : TRAF6 mediated IRF7 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Clone

Cloning Information : 159321
HIP Master Clone ID : 134856
Original Clone ID : FLH159321.01F

Organism


TAX_ID : 9606
Species Specific ID: 29110

Genome

Chromosome : 12
Map Location : 12q14.1
Ensembl : ENSG00000183735

Reagents

Labome : TBK1-antibody