DNASU Plasmid Repository • 480.965.5697 | Email

VCAM1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  VCAM1
Gene Name:  vascular cell adhesion molecule 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH160391.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00021803

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2220nts         Open reading frame : 1 to 2220
Reference Sequence Alignment

ATGCCTGGGAAGATGGTCGTGATCCTTGGAGCCTCAAATATACTTTGGATAATGTTTGCA
GCTTCTCAAGCTTTTAAAATCGAGACCACCCCAGAATCTAGATATCTTGCTCAGATTGGT
GACTCCGTCTCATTGACTTGCAGCACCACAGGCTGTGAGTCCCCATTTTTCTCTTGGAGA
ACCCAGATAGATAGTCCACTGAATGGGAAGGTGACGAATGAGGGGACCACATCTACGCTG
ACAATGAATCCTGTTAGTTTTGGGAACGAACACTCTTACCTGTGCACAGCAACTTGTGAA
TCTAGGAAATTGGAAAAAGGAATCCAGGTGGAGATCTACTCTTTTCCTAAGGATCCAGAG
ATTCATTTGAGTGGCCCTCTGGAGGCTGGGAAGCCGATCACAGTCAAGTGTTCAGTTGCT
GATGTATACCCATTTGACAGGCTGGAGATAGACTTACTGAAAGGAGATCATCTCATGAAG
AGTCAGGAATTTCTGGAGGATGCAGACAGGAAGTCCCTGGAAACCAAGAGTTTGGAAGTA
ACCTTTACTCCTGTCATTGAGGATATTGGAAAAGTTCTTGTTTGCCGAGCTAAATTACAC
ATTGATGAAATGGATTCTGTGCCCACAGTAAGGCAGGCTGTAAAAGAATTGCAAGTCTAC
ATATCACCCAAGAATACAGTTATTTCTGTGAATCCATCCACAAAGCTGCAAGAAGGTGGC
TCTGTGACCATGACCTGTTCCAGCGAGGGTCTACCAGCTCCAGAGATTTTCTGGAGTAAG
AAATTAGATAATGGGAATCTACAGCACCTTTCTGGAAATGCAACTCTCACCTTAATTGCT
ATGAGGATGGAAGATTCTGGAATTTATGTGTGTGAAGGAGTTAATTTGATTGGGAAAAAC
AGAAAAGAGGTGGAATTAATTGTTCAAGAGAAACCATTTACTGTTGAGATCTCCCCTGGA
CCCCGGATTGCTGCTCAGATTGGAGACTCAGTCATGTTGACATGTAGTGTCATGGGCTGT
GAATCCCCATCTTTCTCCTGGAGAACCCAGATAGACAGCCCTCTGAGCGGGAAGGTGAGG
AGTGAGGGGACCAATTCCACGCTGACCCTGAGCCCTGTGAGTTTTGAGAACGAACACTCT
TATCTGTGCACAGTGACTTGTGGACATAAGAAACTGGAAAAGGGAATCCAGGTGGAGCTC
TACTCATTCCCTAGAGATCCAGAAATCGAGATGAGTGGTGGCCTCGTGAATGGGAGCTCT
GTCACTGTAAGCTGCAAGGTTCCTAGCGTGTACCCCCTTGACCGGCTGGAGATTGAATTA
CTTAAGGGGGAGACTATTCTGGAGAATATAGAGTTTTTGGAGGATACGGATATGAAATCT
CTAGAGAACAAAAGTTTGGAAATGACCTTCATCCCTACCATTGAAGATACTGGAAAAGCT
CTTGTTTGTCAGGCTAAGTTACATATTGATGACATGGAATTCGAACCCAAACAAAGGCAG
AGTACGCAAACACTTTATGTCAATGTTGCCCCCAGAGATACAACCGTCTTGGTCAGCCCT
TCCTCCATCCTGGAGGAAGGCAGTTCTGTGAATATGACATGCTTGAGCCAGGGCTTTCCT
GCTCCGAAAATCCTGTGGAGCAGGCAGCTCCCTAACGGGGAGCTACAGCCTCTTTCTGAG
AATGCAACTCTCACCTTAATTTCTACAAAAATGGAAGATTCTGGGGTTTATTTATGTGAA
GGAATTAACCAGGCTGGAAGAAGCAGAAAGGAAGTGGAATTAATTATCCAAGTTACTCCA
AAAGACATAAAACTTACAGCTTTTCCTTCTGAGAGTGTCAAAGAAGGAGACACTGTCATC
ATCTCTTGTACATGTGGAAATGTTCCAGAAACATGGATAATCCTGAAGAAAAAAGCGGAG
ACAGGAGACACAGTACTAAAATCTATAGATGGCGCCTATACCATCCGAAAGGCCCAGTTG
AAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGT
TTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTC
GTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCA
AGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAATCAAAAGTGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2330
Start on reference sequence 111
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : VCAM1
Symbol Nomenclature : VCAM1
SYNONYM : CD106; INCAM-100
Designation : CD106 antigen|vascular cell adhesion protein 1
Full Nomenclature : vascular cell adhesion molecule 1
GENEID : 7412
HGNC : 12663
MIM : 192225
Vega : OTTHUMG00000010982
Target GenBank: BC017276

 

Reference Sequence Alignment

  

HsCD00021803      ATGCCTGGGAAGATGGTCGTGATCCTTGGAGCCTCAAATATACTTTGGATAATGTTTGCA
NM_001078.3       ATGCCTGGGAAGATGGTCGTGATCCTTGGAGCCTCAAATATACTTTGGATAATGTTTGCA
                  ************************************************************

HsCD00021803      GCTTCTCAAGCTTTTAAAATCGAGACCACCCCAGAATCTAGATATCTTGCTCAGATTGGT
NM_001078.3       GCTTCTCAAGCTTTTAAAATCGAGACCACCCCAGAATCTAGATATCTTGCTCAGATTGGT
                  ************************************************************

HsCD00021803      GACTCCGTCTCATTGACTTGCAGCACCACAGGCTGTGAGTCCCCATTTTTCTCTTGGAGA
NM_001078.3       GACTCCGTCTCATTGACTTGCAGCACCACAGGCTGTGAGTCCCCATTTTTCTCTTGGAGA
                  ************************************************************

HsCD00021803      ACCCAGATAGATAGTCCACTGAATGGGAAGGTGACGAATGAGGGGACCACATCTACGCTG
NM_001078.3       ACCCAGATAGATAGTCCACTGAATGGGAAGGTGACGAATGAGGGGACCACATCTACGCTG
                  ************************************************************

HsCD00021803      ACAATGAATCCTGTTAGTTTTGGGAACGAACACTCTTACCTGTGCACAGCAACTTGTGAA
NM_001078.3       ACAATGAATCCTGTTAGTTTTGGGAACGAACACTCTTACCTGTGCACAGCAACTTGTGAA
                  ************************************************************

HsCD00021803      TCTAGGAAATTGGAAAAAGGAATCCAGGTGGAGATCTACTCTTTTCCTAAGGATCCAGAG
NM_001078.3       TCTAGGAAATTGGAAAAAGGAATCCAGGTGGAGATCTACTCTTTTCCTAAGGATCCAGAG
                  ************************************************************

HsCD00021803      ATTCATTTGAGTGGCCCTCTGGAGGCTGGGAAGCCGATCACAGTCAAGTGTTCAGTTGCT
NM_001078.3       ATTCATTTGAGTGGCCCTCTGGAGGCTGGGAAGCCGATCACAGTCAAGTGTTCAGTTGCT
                  ************************************************************

HsCD00021803      GATGTATACCCATTTGACAGGCTGGAGATAGACTTACTGAAAGGAGATCATCTCATGAAG
NM_001078.3       GATGTATACCCATTTGACAGGCTGGAGATAGACTTACTGAAAGGAGATCATCTCATGAAG
                  ************************************************************

HsCD00021803      AGTCAGGAATTTCTGGAGGATGCAGACAGGAAGTCCCTGGAAACCAAGAGTTTGGAAGTA
NM_001078.3       AGTCAGGAATTTCTGGAGGATGCAGACAGGAAGTCCCTGGAAACCAAGAGTTTGGAAGTA
                  ************************************************************

HsCD00021803      ACCTTTACTCCTGTCATTGAGGATATTGGAAAAGTTCTTGTTTGCCGAGCTAAATTACAC
NM_001078.3       ACCTTTACTCCTGTCATTGAGGATATTGGAAAAGTTCTTGTTTGCCGAGCTAAATTACAC
                  ************************************************************

HsCD00021803      ATTGATGAAATGGATTCTGTGCCCACAGTAAGGCAGGCTGTAAAAGAATTGCAAGTCTAC
NM_001078.3       ATTGATGAAATGGATTCTGTGCCCACAGTAAGGCAGGCTGTAAAAGAATTGCAAGTCTAC
                  ************************************************************

HsCD00021803      ATATCACCCAAGAATACAGTTATTTCTGTGAATCCATCCACAAAGCTGCAAGAAGGTGGC
NM_001078.3       ATATCACCCAAGAATACAGTTATTTCTGTGAATCCATCCACAAAGCTGCAAGAAGGTGGC
                  ************************************************************

HsCD00021803      TCTGTGACCATGACCTGTTCCAGCGAGGGTCTACCAGCTCCAGAGATTTTCTGGAGTAAG
NM_001078.3       TCTGTGACCATGACCTGTTCCAGCGAGGGTCTACCAGCTCCAGAGATTTTCTGGAGTAAG
                  ************************************************************

HsCD00021803      AAATTAGATAATGGGAATCTACAGCACCTTTCTGGAAATGCAACTCTCACCTTAATTGCT
NM_001078.3       AAATTAGATAATGGGAATCTACAGCACCTTTCTGGAAATGCAACTCTCACCTTAATTGCT
                  ************************************************************

HsCD00021803      ATGAGGATGGAAGATTCTGGAATTTATGTGTGTGAAGGAGTTAATTTGATTGGGAAAAAC
NM_001078.3       ATGAGGATGGAAGATTCTGGAATTTATGTGTGTGAAGGAGTTAATTTGATTGGGAAAAAC
                  ************************************************************

HsCD00021803      AGAAAAGAGGTGGAATTAATTGTTCAAGAGAAACCATTTACTGTTGAGATCTCCCCTGGA
NM_001078.3       AGAAAAGAGGTGGAATTAATTGTTCAAGAGAAACCATTTACTGTTGAGATCTCCCCTGGA
                  ************************************************************

HsCD00021803      CCCCGGATTGCTGCTCAGATTGGAGACTCAGTCATGTTGACATGTAGTGTCATGGGCTGT
NM_001078.3       CCCCGGATTGCTGCTCAGATTGGAGACTCAGTCATGTTGACATGTAGTGTCATGGGCTGT
                  ************************************************************

HsCD00021803      GAATCCCCATCTTTCTCCTGGAGAACCCAGATAGACAGCCCTCTGAGCGGGAAGGTGAGG
NM_001078.3       GAATCCCCATCTTTCTCCTGGAGAACCCAGATAGACAGCCCTCTGAGCGGGAAGGTGAGG
                  ************************************************************

HsCD00021803      AGTGAGGGGACCAATTCCACGCTGACCCTGAGCCCTGTGAGTTTTGAGAACGAACACTCT
NM_001078.3       AGTGAGGGGACCAATTCCACGCTGACCCTGAGCCCTGTGAGTTTTGAGAACGAACACTCT
                  ************************************************************

HsCD00021803      TATCTGTGCACAGTGACTTGTGGACATAAGAAACTGGAAAAGGGAATCCAGGTGGAGCTC
NM_001078.3       TATCTGTGCACAGTGACTTGTGGACATAAGAAACTGGAAAAGGGAATCCAGGTGGAGCTC
                  ************************************************************

HsCD00021803      TACTCATTCCCTAGAGATCCAGAAATCGAGATGAGTGGTGGCCTCGTGAATGGGAGCTCT
NM_001078.3       TACTCATTCCCTAGAGATCCAGAAATCGAGATGAGTGGTGGCCTCGTGAATGGGAGCTCT
                  ************************************************************

HsCD00021803      GTCACTGTAAGCTGCAAGGTTCCTAGCGTGTACCCCCTTGACCGGCTGGAGATTGAATTA
NM_001078.3       GTCACTGTAAGCTGCAAGGTTCCTAGCGTGTACCCCCTTGACCGGCTGGAGATTGAATTA
                  ************************************************************

HsCD00021803      CTTAAGGGGGAGACTATTCTGGAGAATATAGAGTTTTTGGAGGATACGGATATGAAATCT
NM_001078.3       CTTAAGGGGGAGACTATTCTGGAGAATATAGAGTTTTTGGAGGATACGGATATGAAATCT
                  ************************************************************

HsCD00021803      CTAGAGAACAAAAGTTTGGAAATGACCTTCATCCCTACCATTGAAGATACTGGAAAAGCT
NM_001078.3       CTAGAGAACAAAAGTTTGGAAATGACCTTCATCCCTACCATTGAAGATACTGGAAAAGCT
                  ************************************************************

HsCD00021803      CTTGTTTGTCAGGCTAAGTTACATATTGATGACATGGAATTCGAACCCAAACAAAGGCAG
NM_001078.3       CTTGTTTGTCAGGCTAAGTTACATATTGATGACATGGAATTCGAACCCAAACAAAGGCAG
                  ************************************************************

HsCD00021803      AGTACGCAAACACTTTATGTCAATGTTGCCCCCAGAGATACAACCGTCTTGGTCAGCCCT
NM_001078.3       AGTACGCAAACACTTTATGTCAATGTTGCCCCCAGAGATACAACCGTCTTGGTCAGCCCT
                  ************************************************************

HsCD00021803      TCCTCCATCCTGGAGGAAGGCAGTTCTGTGAATATGACATGCTTGAGCCAGGGCTTTCCT
NM_001078.3       TCCTCCATCCTGGAGGAAGGCAGTTCTGTGAATATGACATGCTTGAGCCAGGGCTTTCCT
                  ************************************************************

HsCD00021803      GCTCCGAAAATCCTGTGGAGCAGGCAGCTCCCTAACGGGGAGCTACAGCCTCTTTCTGAG
NM_001078.3       GCTCCGAAAATCCTGTGGAGCAGGCAGCTCCCTAACGGGGAGCTACAGCCTCTTTCTGAG
                  ************************************************************

HsCD00021803      AATGCAACTCTCACCTTAATTTCTACAAAAATGGAAGATTCTGGGGTTTATTTATGTGAA
NM_001078.3       AATGCAACTCTCACCTTAATTTCTACAAAAATGGAAGATTCTGGGGTTTATTTATGTGAA
                  ************************************************************

HsCD00021803      GGAATTAACCAGGCTGGAAGAAGCAGAAAGGAAGTGGAATTAATTATCCAAGTTACTCCA
NM_001078.3       GGAATTAACCAGGCTGGAAGAAGCAGAAAGGAAGTGGAATTAATTATCCAAGTTACTCCA
                  ************************************************************

HsCD00021803      AAAGACATAAAACTTACAGCTTTTCCTTCTGAGAGTGTCAAAGAAGGAGACACTGTCATC
NM_001078.3       AAAGACATAAAACTTACAGCTTTTCCTTCTGAGAGTGTCAAAGAAGGAGACACTGTCATC
                  ************************************************************

HsCD00021803      ATCTCTTGTACATGTGGAAATGTTCCAGAAACATGGATAATCCTGAAGAAAAAAGCGGAG
NM_001078.3       ATCTCTTGTACATGTGGAAATGTTCCAGAAACATGGATAATCCTGAAGAAAAAAGCGGAG
                  ************************************************************

HsCD00021803      ACAGGAGACACAGTACTAAAATCTATAGATGGCGCCTATACCATCCGAAAGGCCCAGTTG
NM_001078.3       ACAGGAGACACAGTACTAAAATCTATAGATGGCGCCTATACCATCCGAAAGGCCCAGTTG
                  ************************************************************

HsCD00021803      AAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGT
NM_001078.3       AAGGATGCGGGAGTATATGAATGTGAATCTAAAAACAAAGTTGGCTCACAATTAAGAAGT
                  ************************************************************

HsCD00021803      TTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTC
NM_001078.3       TTAACACTTGATGTTCAAGGAAGAGAAAACAACAAAGACTATTTTTCTCCTGAGCTTCTC
                  ************************************************************

HsCD00021803      GTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCA
NM_001078.3       GTGCTCTATTTTGCATCCTCCTTAATAATACCTGCCATTGGAATGATAATTTACTTTGCA
                  ************************************************************

HsCD00021803      AGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAATCAAAAGTGTTG
NM_001078.3       AGAAAAGCCAACATGAAGGGGTCATATAGTCTTGTAGAAGCACAGAAGTCAAAAGTGTAG
                  ***********************************************.**********:*

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : Alpha9 beta1 integrin signaling events
NCI : Beta1 integrin cell surface interactions
NCI : Beta2 integrin cell surface interactions
NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : Cellular roles of Anthrax toxin
NCI : Thromboxane A2 receptor signaling
NCI : a4b7 Integrin signaling
Reactome : Adaptive Immune System
Reactome : Cytokine Signaling in Immune system
Reactome : Extracellular matrix organization
Reactome : Immune System
Reactome : Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell
Reactome : Integrin cell surface interactions
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
WikiPathway : Lymphocyte TarBase
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Squamous cell TarBase

Protein

SMART domain : IG : Immunoglobulin
SMART domain : IGc2 : Immunoglobulin C-2 Type
UniProt : E9PDD1
UniProt : P19320
UniProt : B4DKS4
HPRD : 01888

Clone

Cloning Information : 160391
HIP Master Clone ID : 135926
Original Clone ID : FLH160391.01F

Organism


TAX_ID : 9606
Species Specific ID: 7412

Genome

Chromosome : 1
Map Location : 1p32-p31
Ensembl : ENSG00000162692

Reagents

Labome : VCAM-1-antibody