DNASU Plasmid Repository • 480.965.5697 | Email

ARRB2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ARRB2
Gene Name:  arrestin, beta 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH007756.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00021870

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1185nts         Open reading frame : 1 to 1185
Reference Sequence Alignment

ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGTGTTT
GTGACCCTCACCTGCGCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCC
TTCCGCAAAGACCTGTTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCC
CGGCCCCCCACCCGCCTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCC
TTCTTCTTCACCATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAG
GATACAGGAAAGGCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTA
GAAGAGAAAAGCCACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCC
CCGGAGAAACCCGGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGAC
CGGTCCCTGCACCTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTC
AATGTAAATGTCCACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCT
GTGAGACAGTACGCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCT
CAACTCGAACAAGATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATA
ACCCCACTGCTCAGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAG
CACGAGGACACCAACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTG
CTGGGAATCCTGGTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGAT
GTCTCTGTGGAGCTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTC
CCCAGACCCCAGTCAGCCGCTCCGGAGACAGATGTCCCTGTGGACACCAACCTCATTGAA
TTTGATACCAACTATGCCACAGATGATGACATTGTGTTTGAGGACTTTGCCCGGCTTCGG
CTGAAGGGGATGAAGGATGACGACTATGATGATCAACTCTGCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1283
Start on reference sequence 54
Mutations:
None
Discrepancy:
del@114,45;g426c,G142G;
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ARRB2
Symbol Nomenclature : ARRB2
SYNONYM : ARB2; ARR2; BARR2
Designation : arrestin 3|arrestin beta-2|beta-arrestin-2
Full Nomenclature : arrestin, beta 2
GENEID : 409
GI : 61367912
GenBank Accession : AY891137
HGNC : 712
MIM : 107941
Vega : OTTHUMG00000090759
Target GenBank: NM_004313

 

Reference Sequence Alignment

  

HsCD00021870        ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_001257328.1      ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_001257331.1      ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_001257330.1      ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_004313.3         ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
NM_199004.1         ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACC
                    ************************************************************

HsCD00021870        GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGTG---
NM_001257328.1      GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_001257331.1      GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGTG---
NM_001257330.1      GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_004313.3         GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGC
NM_199004.1         GTGTACTTGGGCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGTG---
                    *******************************************************:    

HsCD00021870        ------------------------------------------TTTGTGACCCTCACCTGC
NM_001257328.1      GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_001257331.1      ------------------------------------------TTTGTGACCCTCACCTGC
NM_001257330.1      GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_004313.3         GTGGTGCTTGTGGACCCTGACTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGC
NM_199004.1         ------------------------------------------TTTGTGACCCTCACCTGC
                                                              ******************

HsCD00021870        GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_001257328.1      GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_001257331.1      GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_001257330.1      GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_004313.3         GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
NM_199004.1         GCCTTCCGCTATGGCCGTGAAGACCTGGATGTGCTGGGCTTGTCCTTCCGCAAAGACCTG
                    ************************************************************

HsCD00021870        TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_001257328.1      TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_001257331.1      TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_001257330.1      TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_004313.3         TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
NM_199004.1         TTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACCCACCCCGGCCCCCCACCCGC
                    ************************************************************

HsCD00021870        CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_001257328.1      CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCGTG
NM_001257331.1      CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_001257330.1      CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_004313.3         CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
NM_199004.1         CTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTTCTTCACCAT-
                    *********************************************************.* 

HsCD00021870        ------------------------------------------------------------
NM_001257328.1      AGGATGCCCCTGCCCTCTGAGGGCCAGGGGGCTGGGGCTGGGACTGTGTCTGGGGTGGGG
NM_001257331.1      ------------------------------------------------------------
NM_001257330.1      ------------------------------------------------------------
NM_004313.3         ------------------------------------------------------------
NM_199004.1         ------------------------------------------------------------
                                                                                

HsCD00021870        --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_001257328.1      ATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_001257331.1      --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_001257330.1      --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_004313.3         --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
NM_199004.1         --ACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAG
                      **********************************************************

HsCD00021870        GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_001257328.1      GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_001257331.1      GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_001257330.1      GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_004313.3         GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
NM_199004.1         GCCTGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGC
                    ************************************************************

HsCD00021870        CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_001257328.1      CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_001257331.1      CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_001257330.1      CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_004313.3         CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
NM_199004.1         CACAAAAGGAACTCTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCC
                    ************************************************************

HsCD00021870        GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_001257328.1      GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_001257331.1      GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_001257330.1      GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_004313.3         GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
NM_199004.1         GGCCCCCAGCCTTCAGCCGAAACCACACGCCACTTCCTCATGTCTGACCGGTCCCTGCAC
                    ************************************************************

HsCD00021870        CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_001257328.1      CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_001257331.1      CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_001257330.1      CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_004313.3         CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
NM_199004.1         CTCGAGGCTTCCCTGGACAAGGAGCTGTACTACCATGGGGAGCCCCTCAATGTAAATGTC
                    ************************************************************

HsCD00021870        CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_001257328.1      CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_001257331.1      CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_001257330.1      CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_004313.3         CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
NM_199004.1         CACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAGTCTCTGTGAGACAGTAC
                    ************************************************************

HsCD00021870        GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_001257328.1      GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_001257331.1      GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_001257330.1      GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_004313.3         GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
NM_199004.1         GCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACTCGAACAA
                    ************************************************************

HsCD00021870        GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_001257328.1      GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_001257331.1      GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_001257330.1      GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_004313.3         GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
NM_199004.1         GATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTC
                    ************************************************************

HsCD00021870        AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_001257328.1      AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_001257331.1      AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_001257330.1      AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_004313.3         AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
NM_199004.1         AGCGACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACC
                    ************************************************************

HsCD00021870        AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_001257328.1      AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_001257331.1      AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_001257330.1      AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_004313.3         AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
NM_199004.1         AACCTGGCTTCCAGCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTG
                    ************************************************************

HsCD00021870        GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_001257328.1      GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_001257331.1      GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_001257330.1      GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_004313.3         GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
NM_199004.1         GTGTCCTACAGGGTCAAGGTGAAGCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAG
                    ************************************************************

HsCD00021870        CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_001257328.1      CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_001257331.1      CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_001257330.1      CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_004313.3         CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
NM_199004.1         CTGCCTTTTGTTCTTATGCACCCCAAGCCCCACGACCACATCCCCCTCCCCAGACCCCAG
                    ************************************************************

HsCD00021870        ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
NM_001257328.1      ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
NM_001257331.1      TCAGCACCCACCCCCACACCCCCTCTTCCCGTCCCCCCAGCCGCTCCGGAGACAGATGTC
NM_001257330.1      TCAGCACCCACCCCCACACCCCCTCTTCCCGTCCCCCCAGCCGCTCCGGAGACAGATGTC
NM_004313.3         ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
NM_199004.1         ------------------------------------TCAGCCGCTCCGGAGACAGATGTC
                                                         ***********************

HsCD00021870        CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_001257328.1      CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_001257331.1      CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_001257330.1      CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_004313.3         CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
NM_199004.1         CCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGACATTGTG
                    ************************************************************

HsCD00021870        TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_001257328.1      TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_001257331.1      TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_001257330.1      TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_004313.3         TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
NM_199004.1         TTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAA
                    ************************************************************

HsCD00021870        CTCTGCTTG
NM_001257328.1      CTCTGCTAG
NM_001257331.1      CTCTGCTAG
NM_001257330.1      CTCTGCTAG
NM_004313.3         CTCTGCTAG
NM_199004.1         CTCTGCTAG
                    *******:*

Pathways

NCI : ALK1 signaling events
NCI : Arf6 signaling events
NCI : Atypical NF-kappaB pathway
NCI : CXCR4-mediated signaling events
NCI : Hedgehog signaling events mediated by Gli proteins
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Noncanonical Wnt signaling pathway
NCI : Signaling events mediated by the Hedgehog family
NCI : TGF-beta receptor signaling
NCI : Thromboxane A2 receptor signaling
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Heterotrimeric G-protein signaling pathway-Gi alpha and Gs alpha mediated pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Wnt signaling pathway
Reactome : Activated NOTCH1 Transmits Signal to the Nucleus
Reactome : Disease
Reactome : FBXW7 Mutants and NOTCH1 in Cancer
Reactome : Hemostasis
Reactome : PCP/CE pathway
Reactome : Platelet activation, signaling and aggregation
Reactome : Signal Transduction
Reactome : Signaling by NOTCH
Reactome : Signaling by NOTCH1
Reactome : Signaling by NOTCH1 HD Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 HD+PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 PEST Domain Mutants in Cancer
Reactome : Signaling by NOTCH1 in Cancer
Reactome : Signaling by NOTCH1 t(7;9)(NOTCH1:M1580_K2555) Translocation Mutant
Reactome : Signaling by Wnt
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : WNT5A-dependent internalization of FZD4
Reactome : beta-catenin independent WNT signaling
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : MAPK signaling pathway
WikiPathway : Myometrial Relaxation and Contraction Pathways

Protein

SMART domain : Arrestin_C : Arrestin (or S-antigen), C-terminal domain
UniProt : P32121
HPRD : 00147

Clone

Cloning Information : 7756
HIP Master Clone ID : 7314
Original Clone ID : FLH007756.01L

Organism


TAX_ID : 9606
Species Specific ID: 409

Genome

Chromosome : 17
Map Location : 17p13
Ensembl : ENSG00000141480

Reagents

Labome : ARRB2-antibody