DNASU Plasmid Repository • 480.965.5697 | Email

SOCS3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SOCS3
Gene Name:  suppressor of cytokine signaling 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH008528.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00021887

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 678nts         Open reading frame : 1 to 678
Reference Sequence Alignment

ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTG
CGCCTCAAGACCTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAG
CTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTC
AGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTC
ACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGC
AGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTG
CTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCT
ACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCC
CCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGG
CCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGTCAACGGCCAC
CTGGACTCCTATGAGAAAGTCACCCAGCTGCCGGGGCCCATTCGGGAGTTCCTGGACCAG
TACGATGCCCCGCTTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 784
Start on reference sequence 107
Mutations:
None
Discrepancy:
g241a,A81T; t373c,Y125H
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SOCS3
Symbol Nomenclature : SOCS3
SYNONYM : ATOD4; CIS3; Cish3; SOCS-3; SSI-3; SSI3
Designation : STAT-induced STAT inhibitor 3|cytokine-inducible SH2 protein 3
Full Nomenclature : suppressor of cytokine signaling 3
GENEID : 9021
GI : 61366718
GenBank Accession : AY890962
HGNC : 19391
MIM : 604176
Vega : OTTHUMG00000177513
Target GenBank: NM_003955

 

Reference Sequence Alignment

  

HsCD00021887      ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTG
NM_003955.4       ATGGTCACCCACAGCAAGTTTCCCGCCGCCGGGATGAGCCGCCCCCTGGACACCAGCCTG
                  ************************************************************

HsCD00021887      CGCCTCAAGACCTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAG
NM_003955.4       CGCCTCAAGACCTTCAGCTCCAAGAGCGAGTACCAGCTGGTGGTGAACGCAGTGCGCAAG
                  ************************************************************

HsCD00021887      CTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTC
NM_003955.4       CTGCAGGAGAGCGGCTTCTACTGGAGCGCAGTGACCGGCGGCGAGGCGAACCTGCTGCTC
                  ************************************************************

HsCD00021887      AGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTC
NM_003955.4       AGTGCCGAGCCCGCCGGCACCTTTCTGATCCGCGACAGCTCGGACCAGCGCCACTTCTTC
                  ************************************************************

HsCD00021887      ACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGC
NM_003955.4       ACGCTCAGCGTCAAGACCCAGTCTGGGACCAAGAACCTGCGCATCCAGTGTGAGGGGGGC
                  ************************************************************

HsCD00021887      AGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTG
NM_003955.4       AGCTTCTCTCTGCAGAGCGATCCCCGGAGCACGCAGCCCGTGCCCCGCTTCGACTGCGTG
                  ************************************************************

HsCD00021887      CTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCT
NM_003955.4       CTCAAGCTGGTGCACCACTACATGCCGCCCCCTGGAGCCCCCTCCTTCCCCTCGCCACCT
                  ************************************************************

HsCD00021887      ACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCC
NM_003955.4       ACTGAACCCTCCTCCGAGGTGCCCGAGCAGCCGTCTGCCCAGCCACTCCCTGGGAGTCCC
                  ************************************************************

HsCD00021887      CCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGG
NM_003955.4       CCCAGAAGAGCCTATTACATCTACTCCGGGGGCGAGAAGATCCCCCTGGTGTTGAGCCGG
                  ************************************************************

HsCD00021887      CCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGTCAACGGCCAC
NM_003955.4       CCCCTCTCCTCCAACGTGGCCACTCTTCAGCATCTCTGTCGGAAGACCGTCAACGGCCAC
                  ************************************************************

HsCD00021887      CTGGACTCCTATGAGAAAGTCACCCAGCTGCCGGGGCCCATTCGGGAGTTCCTGGACCAG
NM_003955.4       CTGGACTCCTATGAGAAAGTCACCCAGCTGCCGGGGCCCATTCGGGAGTTCCTGGACCAG
                  ************************************************************

HsCD00021887      TACGATGCCCCGCTTTTG
NM_003955.4       TACGATGCCCCGCTTTAA
                  ****************:.

Pathways

NCI : ATF-2 transcription factor network
NCI : EPO signaling pathway
NCI : IL2-mediated signaling events
NCI : IL23-mediated signaling events
NCI : IL4-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Signaling events mediated by PTP1B
Panther : Interferon-gamma signaling pathway
Reactome : Adaptive Immune System
Reactome : Antigen processing: Ubiquitination & Proteasome degradation
Reactome : Class I MHC mediated antigen processing & presentation
Reactome : Cytokine Signaling in Immune system
Reactome : Growth hormone receptor signaling
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interleukin-6 signaling
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Signal Transduction
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
WikiPathway : Adipogenesis
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Type II interferon signaling (IFNG)

Protein

SMART domain : SOCS : suppressors of cytokine signalling
SMART domain : SH2 : Src homology 2 domains
SMART domain : SOCS_box :
UniProt : Q6FI39
UniProt : O14543
HPRD : 05006

Clone

Cloning Information : 8528
HIP Master Clone ID : 11023
Original Clone ID : FLH008528.01L

Organism


TAX_ID : 9606
Species Specific ID: 9021

Genome

Chromosome : 17
Map Location : 17q25.3
Ensembl : ENSG00000184557

Reagents

Labome : SOCS3-antibody