DNASU Plasmid Repository • 480.965.5697 | Email

UCK2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  UCK2
Gene Name:  uridine-cytidine kinase 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH012246.01X
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: Short variant or partial clone comparing to NM_012474
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00021936

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 336nts         Open reading frame : 1 to 336
Reference Sequence Alignment

ATGAAGCTTTTTGTGGATACAGATGCGGACACCCGGCTCTCACGCAGAGTATTAAGGGAC
ATCAGCGAGAGAGGCAGGGATCTTGAGCAGATTTTATCTCAGTACATTACGTTCGTCAAG
CCTGCCTTTGAGGAATTCTGCTTGCCAACAAAGAAGTATGCTGATGTGATCATCCCTAGA
GGTGCAGATAATCTGGTGGCCATCAACCTCATCGTGCAGCACATCCAGGACATCCTGAAT
GGAGGGCCCTCCAAACGGCAGACCAATGGCTGTCTCAACGGCTACACCCCTTCACGCAAG
AGGCAGGCATCGGAGTCCAGCAGCAGGCCGCATTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 974
Start on reference sequence 189
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : UCK2
Symbol Nomenclature : UCK2
SYNONYM : TSA903; UK; UMPK
Designation : cytidine monophosphokinase 2|testis-specific protein TSA903|uridine kinase|uridine monophosphate kinase|uridine monophosphokinase 2
Full Nomenclature : uridine-cytidine kinase 2
GENEID : 7371
GI : 60655916
GenBank Accession : AY889731
HGNC : 12562
MIM : 609329
Target GenBank: BC002906

 

Reference Sequence Alignment

  

HsCD00021936      ------------------------------------------------------------
NM_012474.4       ATGGCCGGGGACAGCGAGCAGACCCTGCAGAACCACCAGCAGCCCAACGGCGGCGAGCCC
                                                                              

HsCD00021936      ------------------------------------------------------------
NM_012474.4       TTCCTTATAGGCGTCAGCGGGGGAACAGCTAGCGGCAAGTCTTCCGTGTGTGCTAAGATC
                                                                              

HsCD00021936      ------------------------------------------------------------
NM_012474.4       GTGCAGCTCCTGGGGCAGAATGAGGTGGACTATCGCCAGAAGCAGGTGGTCATCCTGAGC
                                                                              

HsCD00021936      ------------------------------------------------------------
NM_012474.4       CAGGATAGCTTCTACCGTGTCCTTACCTCGGAGCAGAAGGCCAAAGCCCTGAAGGGCCAG
                                                                              

HsCD00021936      ------------------------------------------------------------
NM_012474.4       TTCAACTTTGACCACCCGGATGCCTTTGACAATGAACTCATTCTCAAAACACTCAAAGAA
                                                                              

HsCD00021936      ------------------------------------------------------------
NM_012474.4       ATCACTGAAGGGAAAACAGTCCAGATCCCCGTGTATGACTTTGTCTCCCATTCCCGGAAG
                                                                              

HsCD00021936      ------------------------------------------------------------
NM_012474.4       GAGGAGACAGTTACTGTCTATCCCGCAGACGTGGTGCTCTTTGAAGGGATCCTGGCCTTC
                                                                              

HsCD00021936      ------------------------------ATGAAGCTTTTTGTGGATACAGATGCGGAC
NM_012474.4       TACTCCCAGGAGGTACGAGACCTGTTCCAGATGAAGCTTTTTGTGGATACAGATGCGGAC
                                                ******************************

HsCD00021936      ACCCGGCTCTCACGCAGAGTATTAAGGGACATCAGCGAGAGAGGCAGGGATCTTGAGCAG
NM_012474.4       ACCCGGCTCTCACGCAGAGTATTAAGGGACATCAGCGAGAGAGGCAGGGATCTTGAGCAG
                  ************************************************************

HsCD00021936      ATTTTATCTCAGTACATTACGTTCGTCAAGCCTGCCTTTGAGGAATTCTGCTTGCCAACA
NM_012474.4       ATTTTATCTCAGTACATTACGTTCGTCAAGCCTGCCTTTGAGGAATTCTGCTTGCCAACA
                  ************************************************************

HsCD00021936      AAGAAGTATGCTGATGTGATCATCCCTAGAGGTGCAGATAATCTGGTGGCCATCAACCTC
NM_012474.4       AAGAAGTATGCTGATGTGATCATCCCTAGAGGTGCAGATAATCTGGTGGCCATCAACCTC
                  ************************************************************

HsCD00021936      ATCGTGCAGCACATCCAGGACATCCTGAATGGAGGGCCCTCCAAACGGCAGACCAATGGC
NM_012474.4       ATCGTGCAGCACATCCAGGACATCCTGAATGGAGGGCCCTCCAAACGGCAGACCAATGGC
                  ************************************************************

HsCD00021936      TGTCTCAACGGCTACACCCCTTCACGCAAGAGGCAGGCATCGGAGTCCAGCAGCAGGCCG
NM_012474.4       TGTCTCAACGGCTACACCCCTTCACGCAAGAGGCAGGCATCGGAGTCCAGCAGCAGGCCG
                  ************************************************************

HsCD00021936      CATTAG
NM_012474.4       CATTGA
                  ****..

Pathways

Panther : Salvage pyrimidine ribonucleotides
Reactome : Metabolism
Reactome : Metabolism of nucleotides
Reactome : Pyrimidine metabolism
Reactome : Pyrimidine salvage reactions
WikiPathway : Fluoropyrimidine Activity

Protein

UniProt : Q9BZX2
HPRD : 01882

Clone

Cloning Information : 12246
HIP Master Clone ID : 26445
Original Clone ID : FLH012246.01X

Organism


TAX_ID : 9606
Species Specific ID: 7371

Genome

Chromosome : 1
Map Location : 1q23

Reagents

Labome : UCK2-antibody