DNASU Plasmid Repository • 480.965.5697 | Email

COL4A6 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  COL4A6
Gene Name:  collagen, type IV, alpha 6
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH013561.01X
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: Short variant or partial clone comparing to NM_001847
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00021976

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 222nts         Open reading frame : 1 to 222

ATGCTTATAAACAAGTTGTGGCTGCTCCTGGTTACGTTGTGCCTGACCGAGGAACTGGCA
GCAGCGGGAGAGAAGTCTTATGGAAAGCCATGTGGGGGCCAGGACTGCAGTGGGAGCTGT
CAGTGTTTTCCTGAGAAAGGAGCGAGACACAACTTGCAGCTACTGAATGATATGGCTGGC
CGGCTCTACCATTTCAGTGAGGTTCTGCCTAATCTCTTTTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 348
Start on reference sequence 127
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : COL4A6
Symbol Nomenclature : COL4A6
SYNONYM : CXDELq22.3; DELXq22.3
Designation : collagen IV, alpha-6 polypeptide|collagen alpha-6(IV) chain|collagen of basement membrane, alpha-6|dJ889N15.4 (Collagen Alpha 6(IV))
Full Nomenclature : collagen, type IV, alpha 6
GENEID : 1288
Locus Tag : RP5-889N15.4
HGNC : 2208
MIM : 303631
Vega : OTTHUMG00000022179
Target GenBank: BC005305

 

Pathways

NCI : Beta1 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : Integrins in angiogenesis
NCI : Syndecan-1-mediated signaling events
Panther : Integrin signalling pathway
Reactome : Assembly of collagen fibrils and other multimeric structures
Reactome : Attenuation phase
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Collagen biosynthesis and modifying enzymes
Reactome : Collagen formation
Reactome : Extracellular matrix organization
Reactome : HSF1 activation
Reactome : HSF1-dependent transactivation
Reactome : Regulation of HSF1-mediated heat shock response
WikiPathway : Focal Adhesion

Protein

UniProt : Q9BS57
UniProt : Q14031
HPRD : 02364

Clone

Cloning Information : 13561
HIP Master Clone ID : 27760
Original Clone ID : FLH013561.01X

Organism


TAX_ID : 9606
Species Specific ID: 1288

Genome

Chromosome : X
Map Location : Xq22
Ensembl : ENSG00000197565

Reagents

Labome : COL4A6-antibody