DNASU Plasmid Repository • 480.965.5697 | Email

TGFB3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TGFB3
Gene Name:  transforming growth factor, beta 3
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014084.01X
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: Short variant or partial clone comparing to NM_003239
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00022008

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 930nts         Open reading frame : 1 to 930
Reference Sequence Alignment

ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTC
AGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTG
GAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACG
GTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTG
GAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATAC
TATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTG
GCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAG
AAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGC
TCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATT
GCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTG
TCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGT
CTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAA
AACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGC
CGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTC
ATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGG
GCTTTGGACACCAATTACTGCTTCCGGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1030
Start on reference sequence 101
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : TGFB3
Symbol Nomenclature : TGFB3
SYNONYM : ARVD; ARVD1; RNHF; TGF-beta3
Designation : TGF-beta-3|prepro-transforming growth factor beta-3|transforming growth factor beta-3
Full Nomenclature : transforming growth factor, beta 3
GENEID : 7043
HGNC : 11769
MIM : 190230
Target GenBank: BC018503

 

Reference Sequence Alignment

  

HsCD00022008        ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTC
NM_003239.2         ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTC
XM_005268028.1      ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTC
                    ************************************************************

HsCD00022008        AGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTG
NM_003239.2         AGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTG
XM_005268028.1      AGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTG
                    ************************************************************

HsCD00022008        GAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACG
NM_003239.2         GAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACG
XM_005268028.1      GAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACG
                    ************************************************************

HsCD00022008        GTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTG
NM_003239.2         GTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTG
XM_005268028.1      GTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTG
                    ************************************************************

HsCD00022008        GAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATAC
NM_003239.2         GAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATAC
XM_005268028.1      GAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATAC
                    ************************************************************

HsCD00022008        TATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTG
NM_003239.2         TATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTG
XM_005268028.1      TATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTG
                    ************************************************************

HsCD00022008        GCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAG
NM_003239.2         GCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAG
XM_005268028.1      GCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAG
                    ************************************************************

HsCD00022008        AAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGC
NM_003239.2         AAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGC
XM_005268028.1      AAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGC
                    ************************************************************

HsCD00022008        TCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATT
NM_003239.2         TCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATT
XM_005268028.1      TCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATT
                    ************************************************************

HsCD00022008        GCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTG
NM_003239.2         GCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTG
XM_005268028.1      GCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTG
                    ************************************************************

HsCD00022008        TCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGT
NM_003239.2         TCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGT
XM_005268028.1      TCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGT
                    ************************************************************

HsCD00022008        CTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAA
NM_003239.2         CTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAA
XM_005268028.1      CTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAA
                    ************************************************************

HsCD00022008        AACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGC
NM_003239.2         AACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGC
XM_005268028.1      AACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGC
                    ************************************************************

HsCD00022008        CGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTC
NM_003239.2         CGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTC
XM_005268028.1      CGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTC
                    ************************************************************

HsCD00022008        ATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGG
NM_003239.2         ATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGG
XM_005268028.1      ATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGG
                    ************************************************************

HsCD00022008        GCTTTGGACACCAATTACTGCTTCCGGTAG------------------------------
NM_003239.2         GCTTTGGACACCAATTACTGCTTCCGCAACTTGGAGGAGAACTGCTGTGTGCGCCCCCTC
XM_005268028.1      GCTTTGGACACCAATTACTGCTTCCGCAACTTGGAGGAGAACTGCTGTGTGCGCCCCCTC
                    ************************** :*                               

HsCD00022008        ------------------------------------------------------------
NM_003239.2         TACATTGACTTCCGACAGGATCTGGGCTGGAAGTGGGTCCATGAACCTAAGGGCTACTAT
XM_005268028.1      TACATTGACTTCCGACAGGATCTGGGCTGGAAGTGGGTCCATGAACCTAAGGGCTACTAT
                                                                                

HsCD00022008        ------------------------------------------------------------
NM_003239.2         GCCAACTTCTGCTCAGGCCCTTGCCCATACCTCCGCAGTGCAGACACAACCCACAGCACG
XM_005268028.1      GCCAACTTCTGCTCAGGCCCTTGCCCATACCTCCGCAGTGCAGACACAACCCACAGCACG
                                                                                

HsCD00022008        ------------------------------------------------------------
NM_003239.2         GTGCTGGGACTGTACAACACTCTGAACCCTGAAGCATCTGCCTCGCCTTGCTGCGTGCCC
XM_005268028.1      GTGCTGGGACTGTACAACACTCTGAACCCTGAAGCATCTGCCTCGCCTTGCTGCGTGCCC
                                                                                

HsCD00022008        ------------------------------------------------------------
NM_003239.2         CAGGACCTGGAGCCCCTGACCATCCTGTACTATGTTGGGAGGACCCCCAAAGTGGAGCAG
XM_005268028.1      CAGGACCTGGAGCCCCTGACCATCCTGTACTATGTTGGGAGGACCCCCAAAGTGGAGCAG
                                                                                

HsCD00022008        ---------------------------------------
NM_003239.2         CTCTCCAACATGGTGGTGAAGTCTTGTAAATGTAGCTGA
XM_005268028.1      CTCTCCAACATGGTGGTGAAGTCTTGTAAATGTAGCTGA
                                                           

Pathways

NCI : ALK1 signaling events
NCI : Glypican 1 network
NCI : TGF-beta receptor signaling
Panther : TGF-beta signaling pathway
Reactome : ECM proteoglycans
Reactome : Elastic fibre formation
Reactome : Extracellular matrix organization
Reactome : Hemostasis
Reactome : Molecules associated with elastic fibres
Reactome : Platelet activation, signaling and aggregation
Reactome : Platelet degranulation
Reactome : Response to elevated platelet cytosolic Ca2+
WikiPathway : MAPK signaling pathway

Protein

UniProt : A5YM40
UniProt : P10600
UniProt : B3KVH9
HPRD : 01829

Clone

Cloning Information : 14084
HIP Master Clone ID : 28283
Original Clone ID : FLH014084.01X

Organism


TAX_ID : 9606
Species Specific ID: 7043

Genome

Chromosome : 14
Map Location : 14q24

Reagents

Labome : TGFB3-antibody