DNASU Plasmid Repository • 480.965.5697 | Email

MAPK7 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MAPK7
Gene Name:  mitogen-activated protein kinase 7
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH014954.01L
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: Short variant or partial clone comparing to NM_002749
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00022038

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 2034nts         Open reading frame : 1 to 2034
Reference Sequence Alignment

ATGGAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTG
CGCTACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATC
CACCGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGT
GACTTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACT
GAGTATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTAT
ACACAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGC
CAGCTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGT
ACCCCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAG
AGCTTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAG
GCCCTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCT
GCTGCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGT
GCCCCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAG
GCCATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATC
CGCTTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATG
CCCAGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCA
CCATGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTC
AGTGAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTT
AAAGCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTG
GAGGCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAG
AAGCGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAG
CGAAAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTA
GTGCTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCA
GCCCCAGCCCTCACCTCTGTGCCGGCCCCTGCACCAGCGCCAACGCCAACCCCAACCCCA
GTCCAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAA
TCTGCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCA
CCCCACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACC
TCCACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGC
ACCCCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCC
CCTCAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAG
TCACAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCT
GGCTACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTG
GCTGATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCT
GACTGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATC
CAGATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2411
Start on reference sequence 378
Mutations:
None
Discrepancy:
c1353a
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MAPK7
Symbol Nomenclature : MAPK7
SYNONYM : BMK1; ERK4; ERK5; PRKM7
Designation : BMK-1|BMK1 kinase|ERK-5|MAP kinase 7|MAPK 7|big MAP kinase 1|extracellular signal-regulated kinase 5|extracellular-signal-regulated kinase 5
Full Nomenclature : mitogen-activated protein kinase 7
GENEID : 5598
GI : 60653026
GenBank Accession : AY892291
HGNC : 6880
MIM : 602521
Vega : OTTHUMG00000059587
Target GenBank: BC007992

 

Reference Sequence Alignment

  

HsCD00022038        ------------------------------------------------------------
NM_139033.2         ATGGCCGAGCCTCTGAAGGAGGAAGACGGCGAGGACGGCTCTGCGGAGCCCCCCGGGCCC
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------
NM_139034.2         ATGGCCGAGCCTCTGAAGGAGGAAGACGGCGAGGACGGCTCTGCGGAGCCCCCCGGGCCC
NM_002749.3         ATGGCCGAGCCTCTGAAGGAGGAAGACGGCGAGGACGGCTCTGCGGAGCCCCCCGGGCCC
                                                                                

HsCD00022038        ------------------------------------------------------------
NM_139033.2         GTGAAGGCCGAACCCGCCCACACCGCTGCCTCTGTAGCGGCCAAGAACCTGGCCCTGCTT
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------
NM_139034.2         GTGAAGGCCGAACCCGCCCACACCGCTGCCTCTGTAGCGGCCAAGAACCTGGCCCTGCTT
NM_002749.3         GTGAAGGCCGAACCCGCCCACACCGCTGCCTCTGTAGCGGCCAAGAACCTGGCCCTGCTT
                                                                                

HsCD00022038        ------------------------------------------------------------
NM_139033.2         AAAGCCCGCTCCTTCGATGTGACCTTTGACGTGGGCGACGAGTACGAGATCATCGAGACC
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------
NM_139034.2         AAAGCCCGCTCCTTCGATGTGACCTTTGACGTGGGCGACGAGTACGAGATCATCGAGACC
NM_002749.3         AAAGCCCGCTCCTTCGATGTGACCTTTGACGTGGGCGACGAGTACGAGATCATCGAGACC
                                                                                

HsCD00022038        ------------------------------------------------------------
NM_139033.2         ATAGGCAACGGGGCCTATGGAGTGGTGTCCTCCGCCCGCCGCCGCCTCACCGGCCAGCAG
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------
NM_139034.2         ATAGGCAACGGGGCCTATGGAGTGGTGTCCTCCGCCCGCCGCCGCCTCACCGGCCAGCAG
NM_002749.3         ATAGGCAACGGGGCCTATGGAGTGGTGTCCTCCGCCCGCCGCCGCCTCACCGGCCAGCAG
                                                                                

HsCD00022038        ------------------------------------------------------------
NM_139033.2         GTGGCCATCAAGAAGATCCCTAATGCTTTCGATGTGGTGACCAATGCCAAGCGGACCCTC
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------
NM_139034.2         GTGGCCATCAAGAAGATCCCTAATGCTTTCGATGTGGTGACCAATGCCAAGCGGACCCTC
NM_002749.3         GTGGCCATCAAGAAGATCCCTAATGCTTTCGATGTGGTGACCAATGCCAAGCGGACCCTC
                                                                                

HsCD00022038        ------------------------------------------------------------
NM_139033.2         AGGGAGCTGAAGATCCTCAAGCACTTTAAACACGACAACATCATCGCCATCAAGGACATC
NM_139032.2         ------------------------------------------------------------
XM_005256719.1      ------------------------------------------------------------
NM_139034.2         AGGGAGCTGAAGATCCTCAAGCACTTTAAACACGACAACATCATCGCCATCAAGGACATC
NM_002749.3         AGGGAGCTGAAGATCCTCAAGCACTTTAAACACGACAACATCATCGCCATCAAGGACATC
                                                                                

HsCD00022038        ---------------------------------------------------------ATG
NM_139033.2         CTGAGGCCCACCGTGCCCTATGGCGAATTCAAATCTGTCTACGTGGTCCTGGACCTGATG
NM_139032.2         ---------------------------------------------------------ATG
XM_005256719.1      ---------------------------------------------------------ATG
NM_139034.2         CTGAGGCCCACCGTGCCCTATGGCGAATTCAAATCTGTCTACGTGGTCCTGGACCTGATG
NM_002749.3         CTGAGGCCCACCGTGCCCTATGGCGAATTCAAATCTGTCTACGTGGTCCTGGACCTGATG
                                                                             ***

HsCD00022038        GAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTGCGC
NM_139033.2         GAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTGCGC
NM_139032.2         GAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTGCGC
XM_005256719.1      GAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTGCGC
NM_139034.2         GAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTGCGC
NM_002749.3         GAAAGCGACCTGCACCAGATCATCCACTCCTCACAGCCCCTCACACTGGAACACGTGCGC
                    ************************************************************

HsCD00022038        TACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATCCAC
NM_139033.2         TACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATCCAC
NM_139032.2         TACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATCCAC
XM_005256719.1      TACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATCCAC
NM_139034.2         TACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATCCAC
NM_002749.3         TACTTCCTGTACCAACTGCTGCGGGGCCTGAAGTACATGCACTCGGCTCAGGTCATCCAC
                    ************************************************************

HsCD00022038        CGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGTGAC
NM_139033.2         CGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGTGAC
NM_139032.2         CGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGTGAC
XM_005256719.1      CGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGTGAC
NM_139034.2         CGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGTGAC
NM_002749.3         CGTGACCTGAAGCCCTCCAACCTATTGGTGAATGAGAACTGTGAGCTCAAGATTGGTGAC
                    ************************************************************

HsCD00022038        TTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACTGAG
NM_139033.2         TTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACTGAG
NM_139032.2         TTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACTGAG
XM_005256719.1      TTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACTGAG
NM_139034.2         TTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACTGAG
NM_002749.3         TTTGGTATGGCTCGTGGCCTGTGCACCTCGCCCGCTGAACATCAGTACTTCATGACTGAG
                    ************************************************************

HsCD00022038        TATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTATACA
NM_139033.2         TATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTATACA
NM_139032.2         TATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTATACA
XM_005256719.1      TATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTATACA
NM_139034.2         TATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTATACA
NM_002749.3         TATGTGGCCACGCGCTGGTACCGTGCGCCCGAGCTCATGCTCTCTTTGCATGAGTATACA
                    ************************************************************

HsCD00022038        CAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGCCAG
NM_139033.2         CAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGCCAG
NM_139032.2         CAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGCCAG
XM_005256719.1      CAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGCCAG
NM_139034.2         CAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGCCAG
NM_002749.3         CAGGCTATTGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCCCGGCGCCAG
                    ************************************************************

HsCD00022038        CTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGTACC
NM_139033.2         CTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGTACC
NM_139032.2         CTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGTACC
XM_005256719.1      CTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGTACC
NM_139034.2         CTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGTACC
NM_002749.3         CTCTTCCCAGGCAAAAACTATGTACACCAGCTACAGCTCATCATGATGGTGCTGGGTACC
                    ************************************************************

HsCD00022038        CCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAGAGC
NM_139033.2         CCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAGAGC
NM_139032.2         CCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAGAGC
XM_005256719.1      CCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAGAGC
NM_139034.2         CCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAGAGC
NM_002749.3         CCATCACCAGCCGTGATTCAGGCTGTGGGGGCTGAGAGGGTGCGGGCCTATATCCAGAGC
                    ************************************************************

HsCD00022038        TTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAGGCC
NM_139033.2         TTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAGGCC
NM_139032.2         TTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAGGCC
XM_005256719.1      TTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAGGCC
NM_139034.2         TTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAGGCC
NM_002749.3         TTGCCACCACGCCAGCCTGTGCCCTGGGAGACAGTGTACCCAGGTGCCGACCGCCAGGCC
                    ************************************************************

HsCD00022038        CTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCTGCT
NM_139033.2         CTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCTGCT
NM_139032.2         CTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCTGCT
XM_005256719.1      CTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCTGCT
NM_139034.2         CTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCTGCT
NM_002749.3         CTATCACTGCTGGGTCGCATGCTGCGTTTTGAGCCCAGCGCTCGCATCTCAGCAGCTGCT
                    ************************************************************

HsCD00022038        GCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGTGCC
NM_139033.2         GCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGTGCC
NM_139032.2         GCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGTGCC
XM_005256719.1      GCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGTGCC
NM_139034.2         GCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGTGCC
NM_002749.3         GCCCTTCGCCACCCTTTCCTGGCCAAGTACCATGATCCTGATGATGAGCCTGACTGTGCC
                    ************************************************************

HsCD00022038        CCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAGGCC
NM_139033.2         CCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAGGCC
NM_139032.2         CCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAGGCC
XM_005256719.1      CCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAGGCC
NM_139034.2         CCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAGGCC
NM_002749.3         CCGCCCTTTGACTTTGCCTTTGACCGCGAAGCCCTCACTCGGGAGCGCATTAAGGAGGCC
                    ************************************************************

HsCD00022038        ATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATCCGC
NM_139033.2         ATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATCCGC
NM_139032.2         ATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATCCGC
XM_005256719.1      ATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATCCGC
NM_139034.2         ATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATCCGC
NM_002749.3         ATTGTGGCTGAAATTGAGGACTTCCATGCAAGGCGTGAGGGCATCCGCCAACAGATCCGC
                    ************************************************************

HsCD00022038        TTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATGCCC
NM_139033.2         TTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATGCCC
NM_139032.2         TTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATGCCC
XM_005256719.1      TTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATGCCC
NM_139034.2         TTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATGCCC
NM_002749.3         TTCCAGCCTTCTCTACAGCCTGTGGCTAGTGAGCCTGGCTGTCCAGATGTTGAAATGCCC
                    ************************************************************

HsCD00022038        AGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCACCA
NM_139033.2         AGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCACCA
NM_139032.2         AGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCACCA
XM_005256719.1      AGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCACCA
NM_139034.2         AGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCACCA
NM_002749.3         AGTCCCTGGGCTCCCAGTGGGGACTGTGCCATGGAGTCTCCACCACCAGCCCCGCCACCA
                    ************************************************************

HsCD00022038        TGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTCAGT
NM_139033.2         TGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTCAGT
NM_139032.2         TGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTCAGT
XM_005256719.1      TGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTCAGT
NM_139034.2         TGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTCAGT
NM_002749.3         TGCCCCGGCCCTGCACCTGACACCATTGATCTGACCCTGCAGCCACCTCCACCAGTCAGT
                    ************************************************************

HsCD00022038        GAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTTAAA
NM_139033.2         GAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTTAAA
NM_139032.2         GAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTTAAA
XM_005256719.1      GAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTTAAA
NM_139034.2         GAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTTAAA
NM_002749.3         GAGCCTGCCCCACCAAAGAAAGATGGTGCCATCTCAGACAATACTAAGGCTGCCCTTAAA
                    ************************************************************

HsCD00022038        GCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTGGAG
NM_139033.2         GCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTGGAG
NM_139032.2         GCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTGGAG
XM_005256719.1      GCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTGGAG
NM_139034.2         GCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTGGAG
NM_002749.3         GCTGCCCTGCTCAAGTCTTTGAGGAGCCGGCTCAGAGATGGCCCCAGCGCACCCCTGGAG
                    ************************************************************

HsCD00022038        GCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAGAAG
NM_139033.2         GCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAGAAG
NM_139032.2         GCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAGAAG
XM_005256719.1      GCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAGAAG
NM_139034.2         GCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAGAAG
NM_002749.3         GCTCCTGAGCCTCGGAAGCCGGTGACAGCCCAGGAGCGCCAGCGGGAGCGGGAGGAGAAG
                    ************************************************************

HsCD00022038        CGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAGCGA
NM_139033.2         CGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAGCGA
NM_139032.2         CGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAGCGA
XM_005256719.1      CGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAGCGA
NM_139034.2         CGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAGCGA
NM_002749.3         CGGCGGAGGCGGCAAGAACGAGCCAAGGAGCGGGAGAAACGGCGGCAGGAGCGGGAGCGA
                    ************************************************************

HsCD00022038        AAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTAGTG
NM_139033.2         AAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTAGTG
NM_139032.2         AAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTAGTG
XM_005256719.1      AAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTAGTG
NM_139034.2         AAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTAGTG
NM_002749.3         AAGGAACGGGGGGCTGGGGCCTCTGGGGGCCCCTCCACTGACCCCTTGGCTGGACTAGTG
                    ************************************************************

HsCD00022038        CTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCAGCC
NM_139033.2         CTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCAGCC
NM_139032.2         CTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCAGCC
XM_005256719.1      CTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCAGCC
NM_139034.2         CTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCAGCC
NM_002749.3         CTCAGTGACAATGACAGAAGCCTGTTGGAACGCTGGACTCGAATGGCCCGGCCCGCAGCC
                    ************************************************************

HsCD00022038        CCAGCCCTCACCTCTGTGCCGGCCCCTGCACCAGCGCCAACGCCAACCCCAACCCCAGTC
NM_139033.2         CCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGCCAACGCCAACCCCAACCCCAGTC
NM_139032.2         CCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGCCAACGCCAACCCCAACCCCAGTC
XM_005256719.1      CCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGCCAACGCCAACCCCAACCCCAGTC
NM_139034.2         CCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGCCAACGCCAACCCCAACCCCAGTC
NM_002749.3         CCAGCCCTCACCTCTGTGCCGGCCCCTGCCCCAGCGCCAACGCCAACCCCAACCCCAGTC
                    *****************************.******************************

HsCD00022038        CAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAATCT
NM_139033.2         CAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAATCT
NM_139032.2         CAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAATCT
XM_005256719.1      CAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAATCT
NM_139034.2         CAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAATCT
NM_002749.3         CAACCTACCAGTCCTCCTCCTGGCCCTGTAGCCCAGCCCACTGGCCCGCAACCACAATCT
                    ************************************************************

HsCD00022038        GCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCACCC
NM_139033.2         GCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCACCC
NM_139032.2         GCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCACCC
XM_005256719.1      GCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCACCC
NM_139034.2         GCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCACCC
NM_002749.3         GCGGGCTCTACCTCTGGCCCTGTACCCCAGCCTGCCTGCCCACCCCCTGGCCCTGCACCC
                    ************************************************************

HsCD00022038        CACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACCTCC
NM_139033.2         CACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACCTCC
NM_139032.2         CACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACCTCC
XM_005256719.1      CACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACCTCC
NM_139034.2         CACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACCTCC
NM_002749.3         CACCCCACTGGCCCTCCTGGGCCCATCCCTGTCCCCGCGCCACCCCAGATTGCCACCTCC
                    ************************************************************

HsCD00022038        ACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGCACC
NM_139033.2         ACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGCACC
NM_139032.2         ACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGCACC
XM_005256719.1      ACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGCACC
NM_139034.2         ACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGCACC
NM_002749.3         ACCAGCCTCCTGGCTGCCCAGTCACTTGTGCCACCCCCTGGGCTGCCTGGCTCCAGCACC
                    ************************************************************

HsCD00022038        CCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCCCCT
NM_139033.2         CCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCCCCT
NM_139032.2         CCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCCCCT
XM_005256719.1      CCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCCCCT
NM_139034.2         CCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCCCCT
NM_002749.3         CCAGGAGTTTTGCCTTACTTCCCACCTGGCCTGCCGCCCCCAGACGCCGGGGGAGCCCCT
                    ************************************************************

HsCD00022038        CAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAGTCA
NM_139033.2         CAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAGTCA
NM_139032.2         CAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAGTCA
XM_005256719.1      CAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAGTCA
NM_139034.2         CAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAGTCA
NM_002749.3         CAGTCTTCCATGTCAGAGTCACCTGATGTCAACCTTGTGACCCAGCAGCTATCTAAGTCA
                    ************************************************************

HsCD00022038        CAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGC
NM_139033.2         CAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGC
NM_139032.2         CAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGC
XM_005256719.1      CAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGC
NM_139034.2         CAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGC
NM_002749.3         CAGGTGGAGGACCCCCTGCCCCCTGTGTTCTCAGGCACACCAAAGGGCAGTGGGGCTGGC
                    ************************************************************

HsCD00022038        TACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCT
NM_139033.2         TACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCT
NM_139032.2         TACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCT
XM_005256719.1      TACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCT
NM_139034.2         TACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCT
NM_002749.3         TACGGTGTTGGCTTTGACCTGGAGGAATTCTTAAACCAGTCTTTCGACATGGGCGTGGCT
                    ************************************************************

HsCD00022038        GATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGAC
NM_139033.2         GATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGAC
NM_139032.2         GATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGAC
XM_005256719.1      GATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGAC
NM_139034.2         GATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGAC
NM_002749.3         GATGGGCCACAGGATGGCCAGGCAGATTCAGCCTCTCTCTCAGCCTCCCTGCTTGCTGAC
                    ************************************************************

HsCD00022038        TGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAG
NM_139033.2         TGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAG
NM_139032.2         TGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAG
XM_005256719.1      TGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAG
NM_139034.2         TGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAG
NM_002749.3         TGGCTCGAAGGCCATGGCATGAACCCTGCCGATATTGAGTCCCTGCAGCGTGAGATCCAG
                    ************************************************************

HsCD00022038        ATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTTG
NM_139033.2         ATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGA
NM_139032.2         ATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGA
XM_005256719.1      ATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGA
NM_139034.2         ATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGA
NM_002749.3         ATGGACTCCCCAATGCTGCTGGCTGACCTGCCTGACCTCCAGGACCCCTGA
                    ************************************************* .

Pathways

NCI : ErbB1 downstream signaling
NCI : Trk receptor signaling mediated by the MAPK pathway
Panther : Alzheimer disease-amyloid secretase pathway
Panther : Interleukin signaling pathway
Panther : PDGF signaling pathway
Panther : Parkinson disease
Reactome : Activated TLR4 signalling
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : ERK/MAPK targets
Reactome : ERKs are inactivated
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MAP kinase activation in TLR cascade
Reactome : MAPK targets/ Nuclear events mediated by MAP kinases
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Events (kinase and transcription factor activation)
Reactome : Senescence-Associated Secretory Phenotype (SASP)
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signalling by NGF
Reactome : Signalling to ERK5
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK signaling pathway
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Muscle cell TarBase
WikiPathway : Signal Transduction of S1P Receptor

Clone

Cloning Information : 14954
HIP Master Clone ID : 29153
Original Clone ID : FLH014954.01L

Organism


TAX_ID : 9606
Species Specific ID: 5598

Genome

Chromosome : 17
Map Location : 17p11.2
Ensembl : ENSG00000166484

Reagents

Labome : ERK5-antibody