DNASU Plasmid Repository • 480.965.5697 | Email

MRE11A (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MRE11A
Gene Name:  MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015733.01L
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: Short variant or partial clone comparing to NM_005591
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00022061

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 621nts         Open reading frame : 1 to 621
Reference Sequence Alignment

ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
TTGAGACCAAAGGAAGATTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 770
Start on reference sequence 150
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MRE11A
Symbol Nomenclature : MRE11A
SYNONYM : ATLD; HNGS1; MRE11; MRE11B
Designation : AT-like disease|DNA recombination and repair protein|MRE11 homolog 1|MRE11 homolog A|double-strand break repair protein MRE11A|endo/exonuclease Mre11|meiotic recombination 11 homolog 1|meiotic recombination 11 homolog A
Full Nomenclature : MRE11 meiotic recombination 11 homolog A (S. cerevisiae)
GENEID : 4361
HGNC : 7230
MIM : 600814
Vega : OTTHUMG00000167780
Target GenBank: BC005241

 

Reference Sequence Alignment

  

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATGAGTACTGCAGATGCACTTGATGATGAAAACACATTTAAAATATTAGTTGCAACAGAT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ATTCATCTTGGATTTATGGAGAAAGATGCAGTCAGAGGAAATGATACGTTTGTAACACTC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         GATGAAATTTTAAGACTTGCCCAGGAAAATGAAGTGGATTTTATTTTGTTAGGTGGTGAT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CTTTTTCATGAAAATAAGCCCTCAAGGAAAACATTACATACCTGCCTCGAGTTATTAAGA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         AAATATTGTATGGGTGATCGGCCTGTCCAGTTTGAAATTCTCAGTGATCAGTCAGTCAAC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         TTTGGTTTTAGTAAGTTTCCATGGGTGAACTATCAAGATGGCAACCTCAACATTTCAATT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         CCAGTGTTTAGTATTCATGGCAATCATGACGATCCCACAGGGGCAGATGCACTTTGTGCC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------ATGTCTGTGGAG
NM_005591.3         TTGGACATTTTAAGTTGTGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005591.3         AAGATAGACATTAGTCCGGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005591.3         TTAGGATCCATTCCAGATGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005591.3         TTGAGACCAAAGGAAGATGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005591.3         AGTAAACATGGAAGTACTAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005591.3         GTTATCTGGGGCCATGAACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005591.3         TTTTATATCTCACAACCTGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005591.3         AAGAAACATGTTGGTTTGCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCT
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
XM_005274008.1      CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005591.3         CTTCACACAGTGCGGCAGTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATT
NM_005590.3         ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
XM_005274007.1      ---------------------------------ATGAGTACTGCAGATGCACTTGATGAT
                                                     ** . *. :**:.** .:* :** .:*

HsCD00022061        GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
XM_005274008.1      TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005591.3         TTTAACCCAGATAATCCTAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATT
NM_005590.3         GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
XM_005274007.1      GAAAACACATTTAAAATATTAGTTGCAACAGATATTCATCTTGGATTTATGGAGAAAGAT
                     ::***.** :***:. :::***:.*...**. **:**:.    .* *:*******..:*

HsCD00022061        GCAGTCAG----------------------------------------------------
XM_005274008.1      GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005591.3         GAAGAAATGCTTGAAAATGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAG
NM_005590.3         GCAGTCAG----------------------------------------------------
XM_005274007.1      GCAGTCAG----------------------------------------------------
                    *.**:.*                                                     

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005591.3         CCTCTTGTACGACTGCGAGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGC
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005591.3         TTTAGCCAGAAATTTGTGGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
NM_005591.3         CATAGAGAACAAAAGGAAAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAG
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
NM_005591.3         CCTTCAGAAGGAACAACTTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
NM_005591.3         GAGAAGAATGTGCAGCTCTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAA
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      ------------------------------------------------------------
                                                                                

HsCD00022061        -----AGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAAAAT
XM_005274008.1      TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
NM_005591.3         TTTGTGGACAAGGAGGAGAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAA
NM_005590.3         -----AGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAAAAT
XM_005274007.1      -----AGGAAATGATACGTTTGTAACACTCGATGAAATTTTAAGACTTGCCCAGGAAAAT
                         .*..** ** ..*:::*::.*..* ** ***:*: *.*.* :  .  :******:

HsCD00022061        GAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGGAAA
XM_005274008.1      ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
NM_005591.3         ACACAGCGATTTCTTAAAGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAG
NM_005590.3         GAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGGAAA
XM_005274007.1      GAAGTGGATTTTATTTTGTTAGGTGGTGATCTTTTTCATGAAAATAAGCCCTCAAGGAAA
                    ..* :* .:***.**::. :* ** .*.:* :*   *: ***.* **.. * .:..*.*.

HsCD00022061        ACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTCCAG
XM_005274008.1      GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
NM_005591.3         GTACGTCGTTTCAGAGAAACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGT
NM_005590.3         ACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTCCAG
XM_005274007.1      ACATTACATACCTGCCTCGAGTTATTAAGAAAATATTGTATGGGTGATCGGCCTGTCCAG
                    . *  :*.*: *:*. :... : * :**.***::.*:.*.:.*.:*** .  .:****. 

HsCD00022061        TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTGAAC
XM_005274008.1      GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
NM_005591.3         GAGGCTATGACCAGGGCCAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTT
NM_005590.3         TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTGAAC
XM_005274007.1      TTTGAAATTCTCAGTGATCAGTCAGTCAACTTTGGTTTTAGTAAGTTTCCATGGGTGAAC
                     : *.:** . *** *. ... ** ***..* * . * :.. .*** * *:*  *  :: 

HsCD00022061        TATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCATGAC
XM_005274008.1      AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
NM_005591.3         AGTGCTGATGACCTTATGAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGAT
NM_005590.3         TATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCATGAC
XM_005274007.1      TATCAAGATGGCAACCTCAACATTTCAATTCCAGTGTTTAGTATTCATGGCAATCATGAC
                    :.* .:****.*.: .* *. **: .::*: ***:. : *  . *.***.*:.* **** 

HsCD00022061        G-------------ATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTG
XM_005274008.1      AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
NM_005591.3         AGCATCTCAGCAGCAACCAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGA
NM_005590.3         G-------------ATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTG
XM_005274007.1      G-------------ATCCCACAGGGGCAGATGCACTTTGTGCCTTGGACATTTTAAGTTG
                    .             *:**.***..**.*** **. :  .:*.  * **..:  *...: .

HsCD00022061        TGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCC
XM_005274008.1      GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
NM_005591.3         GGGCAGAATTCAGCATCGAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAG
NM_005590.3         TGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCC
XM_005274007.1      TGCTGGATTTGTAAATCACTTTGGACGTTCAATGTCTGTGGAGAAGATAGACATTAGTCC
                     *  .**:** :..***.. : *.. **  .*:. . *:.***.*** * : .* :* . 

HsCD00022061        GGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCATTCCAGA
XM_005274008.1      ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
NM_005591.3         ACTTCTACCCGTAGCAGGAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATT
NM_005590.3         GGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCATTCCAGA
XM_005274007.1      GGTTTTGCTTCAAAAAGGAAGCACAAAGATTGCGCTATATGGTTTAGGATCCATTCCAGA
                    . ** *.*   :*..*****  ..**...*   *  : *  .* ***.*: .: ** * :

HsCD00022061        TGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGGAAGA
XM_005274008.1      ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
NM_005591.3         ATAGATGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTAT
NM_005590.3         TGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGGAAGA
XM_005274007.1      TGAAAGGCTCTATCGAATGTTTGTCAATAAAAAAGTAACAATGTTGAGACCAAAGGAAGA
                    : *.* **  *::..:.*. ::*:**. *...::  ...***** .. ** **...::.:

HsCD00022061        TTTG--------------------------------------------------------
XM_005274008.1      TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
NM_005591.3         TCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCA
NM_005590.3         TGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGGAGTAAACATGGAAGTAC
XM_005274007.1      TGAGAACTCTTGGTTTAACTTATTTGTGATTCATCAGAACAGGAGTAAACATGGAAGTAC
                    * :*                                                        

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
NM_005591.3         AAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTA
NM_005590.3         TAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTTGTTATCTGGGGCCATGA
XM_005274007.1      TAACTTCATTCCAGAACAATTTTTGGATGACTTCATTGATCTTGTTATCTGGGGCCATGA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
NM_005591.3         TCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACT
NM_005590.3         ACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTGTTTTATATCTCACAACC
XM_005274007.1      ACATGAGTGTAAAATAGCTCCAACCAAAAATGAACAACAGCTGTTTTATATCTCACAACC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      AGTTCTTTAAGAAGAAATAGAAGATAA---------------------------------
NM_005591.3         AGTTCTTTAAGAAGAAATAGAAGATAA---------------------------------
NM_005590.3         TGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTAAAGAAACATGTTGGTTT
XM_005274007.1      TGGAAGCTCAGTGGTTACTTCTCTTTCCCCAGGAGAAGCTGTAAAGAAACATGTTGGTTT
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCTCTTCACACAGTGCGGCA
XM_005274007.1      GCTGCGTATTAAAGGGAGGAAGATGAATATGCATAAAATTCCTCTTCACACAGTGCGGCA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATTTTTAACCCAGATAATCC
XM_005274007.1      GTTTTTCATGGAGGATATTGTTCTAGCTAATCATCCAGACATTTTTAACCCAGATAATCC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATTGAAGAAATGCTTGAAAA
XM_005274007.1      TAAAGTAACCCAAGCCATACAAAGCTTCTGTTTGGAGAAGATTGAAGAAATGCTTGAAAA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAGCCTCTTGTACGACTGCG
XM_005274007.1      TGCTGAACGGGAACGTCTGGGTAATTCTCACCAGCCAGAGAAGCCTCTTGTACGACTGCG
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGCTTTAGCCAGAAATTTGT
XM_005274007.1      AGTGGACTATAGTGGAGGTTTTGAACCTTTCAGTGTTCTTCGCTTTAGCCAGAAATTTGT
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGGCATAGAGAACAAAAGGA
XM_005274007.1      GGATCGGGTAGCTAATCCAAAAGACATTATCCATTTTTTCAGGCATAGAGAACAAAAGGA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAGCCTTCAGAAGGAACAAC
XM_005274007.1      AAAAACAGGAGAAGAGATCAACTTTGGGAAACTTATCACAAAGCCTTCAGAAGGAACAAC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCAGAGAAGAATGTGCAGCT
XM_005274007.1      TTTAAGGGTAGAAGATCTTGTAAAACAGTACTTTCAAACCGCAGAGAAGAATGTGCAGCT
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAGGA
XM_005274007.1      CTCACTGCTAACAGAAAGAGGGATGGGTGAAGCAGTACAAGAATTTGTGGACAAGGAGGA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGCGATTTCTTAA
XM_005274007.1      GAAAGATGCCATTGAGGAATTAGTGAAATACCAGTTGGAAAAAACACAGCGATTTCTTAA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAGGTACGTCGTTTCAGAGA
XM_005274007.1      AGAACGTCATATTGATGCCCTCGAAGACAAAATCGATGAGGAGGTACGTCGTTTCAGAGA
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         AACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGTGAGGCTATGACCAGGGC
XM_005274007.1      AACCAGACAAAAAAATACTAATGAAGAAGATGATGAAGTCCGTGAGGCTATGACCAGGGC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTTAGTGCTGATGACCTTAT
XM_005274007.1      CAGAGCACTCAGATCTCAGTCAGAGGAGTCTGCTTCTGCCTTTAGTGCTGATGACCTTAT
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGATAGCATCTCAGCAGCAAC
XM_005274007.1      GAGTATAGATTTAGCAGAACAGATGGCTAATGACTCTGATGATAGCATCTCAGCAGCAAC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGAGGGCAGAATTCAGCATC
XM_005274007.1      CAACAAAGGAAGAGGCCGAGGAAGAGGTCGAAGAGGTGGAAGAGGGCAGAATTCAGCATC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         GAGAGGAGGGTCTCAAAGAGGAAGAGCCTTTAAATCTACAAGACAGCAGCCTTCCCGAAA
XM_005274007.1      GAGAGGAGGGTCTCAAAGAGGAAGAGCAGACACTGGTCTGGAGACTTCTACCCGTAGCAG
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TGTCACTACTAAGAATTATTCAGAGGTGATTGAGGTAGATGAATCAGATGTGGAAGAAGA
XM_005274007.1      GAACTCAAAGACTGCTGTGTCAGCATCTAGAAATATGTCTATTATAGATGCCTTTAAATC
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CATTTTTCCTACCACTTCAAAGACAGATCAAAGGTGGTCCAGCACATCATCCAGCAAAAT
XM_005274007.1      TACAAGACAGCAGCCTTCCCGAAATGTCACTACTAAGAATTATTCAGAGGTGATTGAGGT
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         CATGTCCCAGAGTCAAGTATCGAAAGGGGTTGATTTTGAATCAAGTGAGGATGATGATGA
XM_005274007.1      AGATGAATCAGATGTGGAAGAAGACATTTTTCCTACCACTTCAAAGACAGATCAAAGGTG
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         TGATCCTTTTATGAACACTAGTTCTTTAAGAAGAAATAGAAGATAA--------------
XM_005274007.1      GTCCAGCACATCATCCAGCAAAATCATGTCCCAGAGTCAAGTATCGAAAGGGGTTGATTT
                                                                                

HsCD00022061        ------------------------------------------------------------
XM_005274008.1      ------------------------------------------------------------
NM_005591.3         ------------------------------------------------------------
NM_005590.3         ------------------------------------------------------------
XM_005274007.1      TGAATCAAGTGAGGATGATGATGATGATCCTTTTATGAACACTAGTTCTTTAAGAAGAAA
                                                                                

HsCD00022061        ----------
XM_005274008.1      ----------
NM_005591.3         ----------
NM_005590.3         ----------
XM_005274007.1      TAGAAGATAA
                              

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
Reactome : Assembly of the RAD50-MRE11-NBS1 complex at DNA double-strand breaks
Reactome : Cell Cycle
Reactome : Cellular Senescence
Reactome : Cellular responses to stress
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : IRF3-mediated induction of type I IFN
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MRN complex relocalizes to nuclear foci
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : STING mediated induction of host immune responses
WikiPathway : DNA damage response
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Non-homologous end joining
WikiPathway : miRNA regulation of DNA Damage Response

Protein

UniProt : Q05D78
UniProt : P49959
HPRD : 02889

Clone

Cloning Information : 15733
HIP Master Clone ID : 29932
Original Clone ID : FLH015733.01L

Organism


TAX_ID : 9606
Species Specific ID: 4361

Genome

Chromosome : 11
Map Location : 11q21
Ensembl : ENSG00000020922

Reagents

Labome : Mre11-antibody