DNASU Plasmid Repository • 480.965.5697 | Email

PLCB2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLCB2
Gene Name:  phospholipase C, beta 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023941.01X
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: Short variant or partial clone comparing to NM_004573
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00022200

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 600nts         Open reading frame : 1 to 600
Reference Sequence Alignment

ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAACCTGGAGGAGCGAGATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 838
Start on reference sequence 239
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLCB2
Symbol Nomenclature : PLCB2
SYNONYM : PLC-beta-2
Designation : 1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase beta-2|phosphoinositide phospholipase C-beta-2
Full Nomenclature : phospholipase C, beta 2
GENEID : 5330
HGNC : 9055
MIM : 604114
Vega : OTTHUMG00000172412
Target GenBank: BC009009

 

Reference Sequence Alignment

  

HsCD00022200        ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
NM_001284298.1      ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
NM_004573.2         ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
XM_005254450.1      ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
NM_001284299.1      ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
XM_005254448.1      ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
XM_005254449.1      ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
NM_001284297.1      ATGTCTCTGCTCAACCCTGTCCTGCTGCCCCCCAAGGTGAAGGCCTATCTGAGCCAAGGG
                    ************************************************************

HsCD00022200        GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
NM_001284298.1      GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
NM_004573.2         GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
XM_005254450.1      GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
NM_001284299.1      GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
XM_005254448.1      GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
XM_005254449.1      GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
NM_001284297.1      GAGCGCTTCATCAAATGGGATGATGAAACTACAGTTGCCTCTCCAGTTATCCTCCGTGTG
                    ************************************************************

HsCD00022200        GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
NM_001284298.1      GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
NM_004573.2         GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
XM_005254450.1      GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
NM_001284299.1      GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
XM_005254448.1      GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
XM_005254449.1      GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
NM_001284297.1      GATCCTAAGGGCTACTACTTATACTGGACGTATCAAAGTAAGGAGATGGAGTTTCTGGAT
                    ************************************************************

HsCD00022200        ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
NM_001284298.1      ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
NM_004573.2         ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
XM_005254450.1      ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
NM_001284299.1      ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
XM_005254448.1      ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
XM_005254449.1      ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
NM_001284297.1      ATCACCAGCATCCGGGATACTCGCTTTGGGAAGTTTGCCAAGATGCCCAAGAGCCAGAAG
                    ************************************************************

HsCD00022200        CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
NM_001284298.1      CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
NM_004573.2         CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
XM_005254450.1      CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
NM_001284299.1      CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
XM_005254448.1      CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
XM_005254449.1      CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
NM_001284297.1      CTCCGGGACGTCTTCAACATGGACTTTCCTGATAACAGTTTCCTGCTGAAGACACTCACG
                    ************************************************************

HsCD00022200        GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
NM_001284298.1      GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
NM_004573.2         GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
XM_005254450.1      GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
NM_001284299.1      GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
XM_005254448.1      GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
XM_005254449.1      GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
NM_001284297.1      GTGGTGTCCGGCCCGGACATGGTGGACCTCACCTTCCACAACTTCGTCTCCTACAAGGAG
                    ************************************************************

HsCD00022200        AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
NM_001284298.1      AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
NM_004573.2         AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
XM_005254450.1      AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
NM_001284299.1      AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
XM_005254448.1      AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
XM_005254449.1      AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
NM_001284297.1      AACGTGGGCAAGGCCTGGGCTGAGGACGTACTGGCCCTAGTCAAACATCCGCTGACGGCC
                    ************************************************************

HsCD00022200        AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
NM_001284298.1      AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
NM_004573.2         AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
XM_005254450.1      AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
NM_001284299.1      AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
XM_005254448.1      AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
XM_005254449.1      AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
NM_001284297.1      AACGCCTCCCGCAGCACCTTCCTGGACAAGATCCTTGTGAAGCTCAAGATGCAGCTCAAC
                    ************************************************************

HsCD00022200        TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
NM_001284298.1      TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
NM_004573.2         TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
XM_005254450.1      TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
NM_001284299.1      TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
XM_005254448.1      TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
XM_005254449.1      TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
NM_001284297.1      TCTGAAGGGAAGATTCCGGTGAAGAACTTTTTCCAGATGTTTCCTGCTGACCGCAAGCGG
                    ************************************************************

HsCD00022200        GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAACCTGGAGGAGCGAGATAG
NM_001284298.1      GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAAAATGACGCCATCAATCCT
NM_004573.2         GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAAAATGACGCCATCAATCCT
XM_005254450.1      GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAAAATGACGCCATCAATCCT
NM_001284299.1      GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAACCTGGAGGAGCGAGATAA
XM_005254448.1      GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAAAATGACGCCATCAATCCT
XM_005254449.1      GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAAAATGACGCCATCAATCCT
NM_001284297.1      GTGGAAGCTGCTCTCAGTGCCTGCCACCTCCCCAAAGGCAAAAATGACGCCATCAATCCT
                    ******************************************..**..* ..  *.: . 

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GAGGACTTCCCAGAACCTGTCTACAAGAGTTTCCTCATGAGCCTCTGTCCTCGGCCAGAA
NM_004573.2         GAGGACTTCCCAGAACCTGTCTACAAGAGTTTCCTCATGAGCCTCTGTCCTCGGCCAGAA
XM_005254450.1      GAGGACTTCCCAGAACCTGTCTACAAGAGTTTCCTCATGAGCCTCTGTCCTCGGCCAGAA
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GAGGACTTCCCAGAACCTGTCTACAAGAGTTTCCTCATGAGCCTCTGTCCTCGGCCAGAA
XM_005254449.1      GAGGACTTCCCAGAACCTGTCTACAAGAGTTTCCTCATGAGCCTCTGTCCTCGGCCAGAA
NM_001284297.1      GAGGACTTCCCAGAACCTGTCTACAAGAGTTTCCTCATGAGCCTCTGTCCTCGGCCAGAA
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      ATAGATGAGATCTTCACTTCTTACCATGCTAAGGCCAAACCCTACATGACGAAGGAGCAC
NM_004573.2         ATAGATGAGATCTTCACTTCTTACCATGCTAAGGCCAAACCCTACATGACGAAGGAGCAC
XM_005254450.1      ATAGATGAGATCTTCACTTCTTACCATGCTAAGGCCAAACCCTACATGACGAAGGAGCAC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ATAGATGAGATCTTCACTTCTTACCATGCTAAGGCCAAACCCTACATGACGAAGGAGCAC
XM_005254449.1      ATAGATGAGATCTTCACTTCTTACCATGCTAAGGCCAAACCCTACATGACGAAGGAGCAC
NM_001284297.1      ATAGATGAGATCTTCACTTCTTACCATGCTAAGGCCAAACCCTACATGACGAAGGAGCAC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CTGACCAAATTCATCAACCAGAAACAGCGGGACTCCCGGCTTAACTCCCTGCTGTTCCCG
NM_004573.2         CTGACCAAATTCATCAACCAGAAACAGCGGGACTCCCGGCTTAACTCCCTGCTGTTCCCG
XM_005254450.1      CTGACCAAATTCATCAACCAGAAACAGCGGGACTCCCGGCTTAACTCCCTGCTGTTCCCG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CTGACCAAATTCATCAACCAGAAACAGCGGGACTCCCGGCTTAACTCCCTGCTGTTCCCG
XM_005254449.1      CTGACCAAATTCATCAACCAGAAACAGCGGGACTCCCGGCTTAACTCCCTGCTGTTCCCG
NM_001284297.1      CTGACCAAATTCATCAACCAGAAACAGCGGGACTCCCGGCTTAACTCCCTGCTGTTCCCG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CCAGCACGGCCTGACCAGGTGCAGGGCCTCATCGACAAGTATGAGCCCAGTGGCATCAAT
NM_004573.2         CCAGCACGGCCTGACCAGGTGCAGGGCCTCATCGACAAGTATGAGCCCAGTGGCATCAAT
XM_005254450.1      CCAGCACGGCCTGACCAGGTGCAGGGCCTCATCGACAAGTATGAGCCCAGTGGCATCAAT
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CCAGCACGGCCTGACCAGGTGCAGGGCCTCATCGACAAGTATGAGCCCAGTGGCATCAAT
XM_005254449.1      CCAGCACGGCCTGACCAGGTGCAGGGCCTCATCGACAAGTATGAGCCCAGTGGCATCAAT
NM_001284297.1      CCAGCACGGCCTGACCAGGTGCAGGGCCTCATCGACAAGTATGAGCCCAGTGGCATCAAT
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCACAGAGGGGCCAGCTGTCACCTGAAGGCATGGTCTGGTTTCTCTGTGGGCCAGAGAAC
NM_004573.2         GCACAGAGGGGCCAGCTGTCACCTGAAGGCATGGTCTGGTTTCTCTGTGGGCCAGAGAAC
XM_005254450.1      GCACAGAGGGGCCAGCTGTCACCTGAAGGCATGGTCTGGTTTCTCTGTGGGCCAGAGAAC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCACAGAGGGGCCAGCTGTCACCTGAAGGCATGGTCTGGTTTCTCTGTGGGCCAGAGAAC
XM_005254449.1      GCACAGAGGGGCCAGCTGTCACCTGAAGGCATGGTCTGGTTTCTCTGTGGGCCAGAGAAC
NM_001284297.1      GCACAGAGGGGCCAGCTGTCACCTGAAGGCATGGTCTGGTTTCTCTGTGGGCCAGAGAAC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AGCGTGCTGGCCCAGGACAAGCTGCTGCTCCACCACGACATGACGCAGCCACTCAATCAT
NM_004573.2         AGCGTGCTGGCCCAGGACAAGCTGCTGCTCCACCACGACATGACGCAGCCACTCAATCAT
XM_005254450.1      AGCGTGCTGGCCCAGGACAAGCTGCTGCTCCACCACGACATGACGCAGCCACTCAATCAT
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AGCGTGCTGGCCCAGGACAAGCTGCTGCTCCACCACGACATGACGCAGCCACTCAATCAT
XM_005254449.1      AGCGTGCTGGCCCAGGACAAGCTGCTGCTCCACCACGACATGACGCAGCCACTCAATCAT
NM_001284297.1      AGCGTGCTGGCCCAGGACAAGCTGCTGCTCCACCACGACATGACGCAGCCACTCAATCAT
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TACTTCATCAACTCGTCCCACAACACCTACCTGACAGCCGGCCAGTTCTCAGGCCTCTCC
NM_004573.2         TACTTCATCAACTCGTCCCACAACACCTACCTGACAGCCGGCCAGTTCTCAGGCCTCTCC
XM_005254450.1      TACTTCATCAACTCGTCCCACAACACCTACCTGACAGCCGGCCAGTTCTCAGGCCTCTCC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TACTTCATCAACTCGTCCCACAACACCTACCTGACAGCCGGCCAGTTCTCAGGCCTCTCC
XM_005254449.1      TACTTCATCAACTCGTCCCACAACACCTACCTGACAGCCGGCCAGTTCTCAGGCCTCTCC
NM_001284297.1      TACTTCATCAACTCGTCCCACAACACCTACCTGACAGCCGGCCAGTTCTCAGGCCTCTCC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TCGGCTGAGATGTACCGCCAGGTGCTGCTCTCTGGCTGCCGTTGCGTGGAGCTAGACTGC
NM_004573.2         TCGGCTGAGATGTACCGCCAGGTGCTGCTCTCTGGCTGCCGTTGCGTGGAGCTAGACTGC
XM_005254450.1      TCGGCTGAGATGTACCGCCAGGTGCTGCTCTCTGGCTGCCGTTGCGTGGAGCTAGACTGC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TCGGCTGAGATGTACCGCCAGGTGCTGCTCTCTGGCTGCCGTTGCGTGGAGCTAGACTGC
XM_005254449.1      TCGGCTGAGATGTACCGCCAGGTGCTGCTCTCTGGCTGCCGTTGCGTGGAGCTAGACTGC
NM_001284297.1      TCGGCTGAGATGTACCGCCAGGTGCTGCTCTCTGGCTGCCGTTGCGTGGAGCTAGACTGC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TGGAAGGGGAAACCCCCTGACGAGGAGCCCATTATCACCCATGGCTTCACCATGACCACA
NM_004573.2         TGGAAGGGGAAACCCCCTGACGAGGAGCCCATTATCACCCATGGCTTCACCATGACCACA
XM_005254450.1      TGGAAGGGGAAACCCCCTGACGAGGAGCCCATTATCACCCATGGCTTCACCATGACCACA
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TGGAAGGGGAAACCCCCTGACGAGGAGCCCATTATCACCCATGGCTTCACCATGACCACA
XM_005254449.1      TGGAAGGGGAAACCCCCTGACGAGGAGCCCATTATCACCCATGGCTTCACCATGACCACA
NM_001284297.1      TGGAAGGGGAAACCCCCTGACGAGGAGCCCATTATCACCCATGGCTTCACCATGACCACA
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GACATCTTCTTCAAAGAAGCAATTGAGGCTATTGCAGAAAGCGCCTTTAAGACCTCCCCC
NM_004573.2         GACATCTTCTTCAAAGAAGCAATTGAGGCTATTGCAGAAAGCGCCTTTAAGACCTCCCCC
XM_005254450.1      GACATCTTCTTCAAAGAAGCAATTGAGGCTATTGCAGAAAGCGCCTTTAAGACCTCCCCC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GACATCTTCTTCAAAGAAGCAATTGAGGCTATTGCAGAAAGCGCCTTTAAGACCTCCCCC
XM_005254449.1      GACATCTTCTTCAAAGAAGCAATTGAGGCTATTGCAGAAAGCGCCTTTAAGACCTCCCCC
NM_001284297.1      GACATCTTCTTCAAAGAAGCAATTGAGGCTATTGCAGAAAGCGCCTTTAAGACCTCCCCC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TATCCCATCATCCTGTCGTTTGAGAACCATGTGGACTCACCCCGCCAGCAGGCTAAGATG
NM_004573.2         TATCCCATCATCCTGTCGTTTGAGAACCATGTGGACTCACCCCGCCAGCAGGCTAAGATG
XM_005254450.1      TATCCCATCATCCTGTCGTTTGAGAACCATGTGGACTCACCCCGCCAGCAGGCTAAGATG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TATCCCATCATCCTGTCGTTTGAGAACCATGTGGACTCACCCCGCCAGCAGGCTAAGATG
XM_005254449.1      TATCCCATCATCCTGTCGTTTGAGAACCATGTGGACTCACCCCGCCAGCAGGCTAAGATG
NM_001284297.1      TATCCCATCATCCTGTCGTTTGAGAACCATGTGGACTCACCCCGCCAGCAGGCTAAGATG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCTGAGTATTGCCGGACGATCTTTGGGGATATGCTGCTCACAGAGCCCCTGGAAAAGTTC
NM_004573.2         GCTGAGTATTGCCGGACGATCTTTGGGGATATGCTGCTCACAGAGCCCCTGGAAAAGTTC
XM_005254450.1      GCTGAGTATTGCCGGACGATCTTTGGGGATATGCTGCTCACAGAGCCCCTGGAAAAGTTC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCTGAGTATTGCCGGACGATCTTTGGGGATATGCTGCTCACAGAGCCCCTGGAAAAGTTC
XM_005254449.1      GCTGAGTATTGCCGGACGATCTTTGGGGATATGCTGCTCACAGAGCCCCTGGAAAAGTTC
NM_001284297.1      GCTGAGTATTGCCGGACGATCTTTGGGGATATGCTGCTCACAGAGCCCCTGGAAAAGTTC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CCACTAAAACCAGGTGTCCCCCTGCCCAGCCCTGAGGATCTCAGGGGCAAGATCCTCATC
NM_004573.2         CCACTAAAACCAGGTGTCCCCCTGCCCAGCCCTGAGGATCTCAGGGGCAAGATCCTCATC
XM_005254450.1      CCACTAAAACCAGGTGTCCCCCTGCCCAGCCCTGAGGATCTCAGGGGCAAGATCCTCATC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CCACTAAAACCAGGTGTCCCCCTGCCCAGCCCTGAGGATCTCAGGGGCAAGATCCTCATC
XM_005254449.1      CCACTAAAACCAGGTGTCCCCCTGCCCAGCCCTGAGGATCTCAGGGGCAAGATCCTCATC
NM_001284297.1      CCACTAAAACCAGGTGTCCCCCTGCCCAGCCCTGAGGATCTCAGGGGCAAGATCCTCATC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AAGAACAAGAAGAACCAGTTTTCTGGCCCCACCTCCTCCAGTAAGGATACTGGTGGGGAG
NM_004573.2         AAGAACAAGAAGAACCAGTTTTCTGGCCCCACCTCCTCCAGTAAGGATACTGGTGGGGAG
XM_005254450.1      AAGAACAAGAAGAACCAGTTTTCTGGCCCCACCTCCTCCAGTAAGGATACTGGTGGGGAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AAGAACAAGAAGAACCAGTTTTCTGGCCCCACCTCCTCCAGTAAGGATACTGGTGGGGAG
XM_005254449.1      AAGAACAAGAAGAACCAGTTTTCTGGCCCCACCTCCTCCAGTAAGGATACTGGTGGGGAG
NM_001284297.1      AAGAACAAGAAGAACCAGTTTTCTGGCCCCACCTCCTCCAGTAAGGATACTGGTGGGGAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCTGAGGGCAGCAGCCCACCCAGTGCCCCTGCAGGTGAGGGCACAGTGTGGGCTGGCGAG
NM_004573.2         GCTGAGGGCAGCAGCCCACCCAGTGCCCCTGCAGGTGAGGGCACAGTGTGGGCTGGCGAG
XM_005254450.1      GCTGAGGGCAGCAGCCCACCCAGTGCCCCTGCAGGTGAGGGCACAGTGTGGGCTGGCGAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCTGAGGGCAGCAGCCCACCCAGTGCCCCTGCAGGTGAGGGCACAGTGTGGGCTGGCGAG
XM_005254449.1      GCTGAGGGCAGCAGCCCACCCAGTGCCCCTGCAGGTGAGGGCACAGTGTGGGCTGGCGAG
NM_001284297.1      GCTGAGGGCAGCAGCCCACCCAGTGCCCCTGCAG------------TGTGGGCTGGCGAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GAAGGGACTGAGCTGGAGGAGGAGGAGGTGGAAGAGGAAGAGGAGGAGGAGTCAGGAAAC
NM_004573.2         GAAGGGACTGAGCTGGAGGAGGAGGAGGTGGAAGAGGAAGAGGAGGAGGAGTCAGGAAAC
XM_005254450.1      GAAGGGACTGAGCTGGAGGAGGAGGAGGTGGAAGAGGAAGAGGAGGAGGAGTCAGGAAAC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GAAGGGACTGAGCTGGAGGAGGAGGAGGTGGAAGAGGAAGAGGAGGAGGAGTCAGGAAAC
XM_005254449.1      GAAGGGACTGAGCTGGAGGAGGAGGAGGTGGAAGAGGAAGAGGAGGAGGAGTCAGGAAAC
NM_001284297.1      GAAGGGACTGAGCTGGAGGAGGAGGAGGTGGAAGAGGAAGAGGAGGAGGAGTCAGGAAAC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CTGGATGAAGAAGAGATTAAGAAGATGCAGTCGGATGAGGGCACAGCGGGCCTGGAAGTG
NM_004573.2         CTGGATGAAGAAGAGATTAAGAAGATGCAGTCGGATGAGGGCACAGCGGGCCTGGAAGTG
XM_005254450.1      CTGGATGAAGAAGAGATTAAGAAGATGCAGTCGGATGAGGGCACAGCGGGCCTGGAAGTG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CTGGATGAAGAAGAGATTAAGAAGATGCAGTCGGATGAGGGCACAGCGGGCCTGGAAGTG
XM_005254449.1      CTGGATGAAGAAGAGATTAAGAAGATGCAGTCGGATGAGGGCACAGCGGGCCTGGAAGTG
NM_001284297.1      CTGGATGAAGAAGAGATTAAGAAGATGCAGTCGGATGAGGGCACAGCGGGCCTGGAAGTG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      ACGGCTTATGAGGAGATGTCCAGCCTAGTCAATTACATCCAGCCCACCAAGTTCGTCTCC
NM_004573.2         ACGGCTTATGAGGAGATGTCCAGCCTAGTCAATTACATCCAGCCCACCAAGTTCGTCTCC
XM_005254450.1      ACGGCTTATGAGGAGATGTCCAGCCTAGTCAATTACATCCAGCCCACCAAGTTCGTCTCC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ACGGCTTATGAGGAGATGTCCAGCCTAGTCAATTACATCCAGCCCACCAAGTTCGTCTCC
XM_005254449.1      ACGGCTTATGAGGAGATGTCCAGCCTAGTCAATTACATCCAGCCCACCAAGTTCGTCTCC
NM_001284297.1      ACGGCTTATGAGGAGATGTCCAGCCTAGTCAATTACATCCAGCCCACCAAGTTCGTCTCC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TTTGAGTTCTCTGCCCAAAAGAACCGAAGTTATGTCATCTCGTCCTTCACAGAGCTCAAG
NM_004573.2         TTTGAGTTCTCTGCCCAAAAGAACCGAAGTTATGTCATCTCGTCCTTCACAGAGCTCAAG
XM_005254450.1      TTTGAGTTCTCTGCCCAAAAGAACCGAAGTTATGTCATCTCGTCCTTCACAGAGCTCAAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TTTGAGTTCTCTGCCCAAAAGAACCGAAGTTATGTCATCTCGTCCTTCACAGAGCTCAAG
XM_005254449.1      TTTGAGTTCTCTGCCCAAAAGAACCGAAGTTATGTCATCTCGTCCTTCACAGAGCTCAAG
NM_001284297.1      TTTGAGTTCTCTGCCCAAAAGAACCGAAGTTATGTCATCTCGTCCTTCACAGAGCTCAAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCATATGACCTGCTCTCCAAGGCCTCGGTGCAGTTTGTGGACTACAACAAGCGCCAGATG
NM_004573.2         GCATATGACCTGCTCTCCAAGGCCTCGGTGCAGTTTGTGGACTACAACAAGCGCCAGATG
XM_005254450.1      GCATATGACCTGCTCTCCAAGGCCTCGGTGCAGTTTGTGGACTACAACAAGCGCCAGATG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCATATGACCTGCTCTCCAAGGCCTCGGTGCAGTTTGTGGACTACAACAAGCGCCAGATG
XM_005254449.1      GCATATGACCTGCTCTCCAAGGCCTCGGTGCAGTTTGTGGACTACAACAAGCGCCAGATG
NM_001284297.1      GCATATGACCTGCTCTCCAAGGCCTCGGTGCAGTTTGTGGACTACAACAAGCGCCAGATG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AGCCGCATTTACCCCAAGGGAACCCGCATGGACTCCTCCAACTACATGCCCCAGATGTTC
NM_004573.2         AGCCGCATTTACCCCAAGGGAACCCGCATGGACTCCTCCAACTACATGCCCCAGATGTTC
XM_005254450.1      AGCCGCATTTACCCCAAGGGAACCCGCATGGACTCCTCCAACTACATGCCCCAGATGTTC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AGCCGCATTTACCCCAAGGGAACCCGCATGGACTCCTCCAACTACATGCCCCAGATGTTC
XM_005254449.1      AGCCGCATTTACCCCAAGGGAACCCGCATGGACTCCTCCAACTACATGCCCCAGATGTTC
NM_001284297.1      AGCCGCATTTACCCCAAGGGAACCCGCATGGACTCCTCCAACTACATGCCCCAGATGTTC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TGGAATGCTGGATGCCAGATGGTTGCCCTCAACTTCCAGACGATGGACTTGCCCATGCAG
NM_004573.2         TGGAATGCTGGATGCCAGATGGTTGCCCTCAACTTCCAGACGATGGACTTGCCCATGCAG
XM_005254450.1      TGGAATGCTGGATGCCAGATGGTTGCCCTCAACTTCCAGACGATGGACTTGCCCATGCAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TGGAATGCTGGATGCCAGATGGTTGCCCTCAACTTCCAGACGATGGACTTGCCCATGCAG
XM_005254449.1      TGGAATGCTGGATGCCAGATGGTTGCCCTCAACTTCCAGACGATGGACTTGCCCATGCAG
NM_001284297.1      TGGAATGCTGGATGCCAGATGGTTGCCCTCAACTTCCAGACGATGGACTTGCCCATGCAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CAGAACATGGCAGTATTTGAGTTCAACGGGCAGAGCGGCTACCTCCTCAAGCATGAGTTC
NM_004573.2         CAGAACATGGCAGTATTTGAGTTCAACGGGCAGAGCGGCTACCTCCTCAAGCATGAGTTC
XM_005254450.1      CAGAACATGGCAGTATTTGAGTTCAACGGGCAGAGCGGCTACCTCCTCAAGCATGAGTTC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CAGAACATGGCAGTATTTGAGTTCAACGGGCAGAGCGGCTACCTCCTCAAGCATGAGTTC
XM_005254449.1      CAGAACATGGCAGTATTTGAGTTCAACGGGCAGAGCGGCTACCTCCTCAAGCATGAGTTC
NM_001284297.1      CAGAACATGGCAGTATTTGAGTTCAACGGGCAGAGCGGCTACCTCCTCAAGCATGAGTTC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      ATGCGCCGGCCGGACAAGCAGTTCAACCCCTTCTCAGTGGACCGCATCGACGTGGTGGTG
NM_004573.2         ATGCGCCGGCCGGACAAGCAGTTCAACCCCTTCTCAGTGGACCGCATCGACGTGGTGGTG
XM_005254450.1      ATGCGCCGGCCGGACAAGCAGTTCAACCCCTTCTCAGTGGACCGCATCGACGTGGTGGTG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ATGCGCCGGCCGGACAAGCAGTTCAACCCCTTCTCAGTGGACCGCATCGACGTGGTGGTG
XM_005254449.1      ATGCGCCGGCCGGACAAGCAGTTCAACCCCTTCTCAGTGGACCGCATCGACGTGGTGGTG
NM_001284297.1      ATGCGCCGGCCGGACAAGCAGTTCAACCCCTTCTCAGTGGACCGCATCGACGTGGTGGTG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCCACCACCCTTTCCATTACGGTGATCTCTGGGCAGTTCCTGTCAGAACGCAGCGTGCGC
NM_004573.2         GCCACCACCCTTTCCATTACGGTGATCTCTGGGCAGTTCCTGTCAGAACGCAGCGTGCGC
XM_005254450.1      GCCACCACCCTTTCCATTACGGTGATCTCTGGGCAGTTCCTGTCAGAACGCAGCGTGCGC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCCACCACCCTTTCCATTACGGTGATCTCTGGGCAGTTCCTGTCAGAACGCAGCGTGCGC
XM_005254449.1      GCCACCACCCTTTCCATTACGGTGATCTCTGGGCAGTTCCTGTCAGAACGCAGCGTGCGC
NM_001284297.1      GCCACCACCCTTTCCATTACGGTGATCTCTGGGCAGTTCCTGTCAGAACGCAGCGTGCGC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      ACCTATGTAGAAGTGGAGCTGTTTGGCCTTCCTGGGGACCCCAAGAGGCGCTATCGAACT
NM_004573.2         ACCTATGTAGAAGTGGAGCTGTTTGGCCTTCCTGGGGACCCCAAGAGGCGCTATCGAACT
XM_005254450.1      ACCTATGTAGAAGTGGAGCTGTTTGGCCTTCCTGGGGACCCCAAGAGGCGCTATCGAACT
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ACCTATGTAGAAGTGGAGCTGTTTGGCCTTCCTGGGGACCCCAAGAGGCGCTATCGAACT
XM_005254449.1      ACCTATGTAGAAGTGGAGCTGTTTGGCCTTCCTGGGGACCCCAAGAGGCGCTATCGAACT
NM_001284297.1      ACCTATGTAGAAGTGGAGCTGTTTGGCCTTCCTGGGGACCCCAAGAGGCGCTATCGAACT
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AAGCTGTCACCCAGTACTAACTCCATCAATCCTGTCTGGAAGGAGGAGCCCTTTGTCTTT
NM_004573.2         AAGCTGTCACCCAGTACTAACTCCATCAATCCTGTCTGGAAGGAGGAGCCCTTTGTCTTT
XM_005254450.1      AAGCTGTCACCCAGTACTAACTCCATCAATCCTGTCTGGAAGGAGGAGCCCTTTGTCTTT
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AAGCTGTCACCCAGTACTAACTCCATCAATCCTGTCTGGAAGGAGGAGCCCTTTGTCTTT
XM_005254449.1      AAGCTGTCACCCAGTACTAACTCCATCAATCCTGTCTGGAAGGAGGAGCCCTTTGTCTTT
NM_001284297.1      AAGCTGTCACCCAGTACTAACTCCATCAATCCTGTCTGGAAGGAGGAGCCCTTTGTCTTT
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GAGAAGATCTTGATGCCTGAGCTGGCCTCCCTCAGAGTGGCTGTGATGGAGGAAGGCAAC
NM_004573.2         GAGAAGATCTTGATGCCTGAGCTGGCCTCCCTCAGAGTGGCTGTGATGGAGGAAGGCAAC
XM_005254450.1      GAGAAGATCTTGATGCCTGAGCTGGCCTCCCTCAGAGTGGCTGTGATGGAGGAAGGCAAC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GAGAAGATCTTGATGCCTGAGCTGGCCTCCCTCAGAGTGGCTGTGATGGAGGAAGGCAAC
XM_005254449.1      GAGAAGATCTTGATGCCTGAGCTGGCCTCCCTCAGAGTGGCTGTGATGGAGGAAGGCAAC
NM_001284297.1      GAGAAGATCTTGATGCCTGAGCTGGCCTCCCTCAGAGTGGCTGTGATGGAGGAAGGCAAC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AAGTTTCTTGGACACCGCATCATCCCCATCAATGCCCTAAATTCTGGGTACCACCACCTG
NM_004573.2         AAGTTTCTTGGACACCGCATCATCCCCATCAATGCCCTAAATTCTGGGTACCACCACCTG
XM_005254450.1      AAGTTTCTTGGACACCGCATCATCCCCATCAATGCCCTAAATTCTGGGTACCACCACCTG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AAGTTTCTTGGACACCGCATCATCCCCATCAATGCCCTAAATTCTGGGTACCACCACCTG
XM_005254449.1      AAGTTTCTTGGACACCGCATCATCCCCATCAATGCCCTAAATTCTGGGTACCACCACCTG
NM_001284297.1      AAGTTTCTTGGACACCGCATCATCCCCATCAATGCCCTAAATTCTGGGTACCACCACCTG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TGCCTGCACAGTGAGAGCAACATGCCCCTCACCATGCCTGCGCTCTTCATCTTCCTGGAG
NM_004573.2         TGCCTGCACAGTGAGAGCAACATGCCCCTCACCATGCCTGCGCTCTTCATCTTCCTGGAG
XM_005254450.1      TGCCTGCACAGTGAGAGCAACATGCCCCTCACCATGCCTGCGCTCTTCATCTTCCTGGAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TGCCTGCACAGTGAGAGCAACATGCCCCTCACCATGCCTGCGCTCTTCATCTTCCTGGAG
XM_005254449.1      TGCCTGCACAGTGAGAGCAACATGCCCCTCACCATGCCTGCGCTCTTCATCTTCCTGGAG
NM_001284297.1      TGCCTGCACAGTGAGAGCAACATGCCCCTCACCATGCCTGCGCTCTTCATCTTCCTGGAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      ATGAAGGACTACATACCTGGTGCTTGGGCAGATCTCACTGTGGCCCTCGCCAACCCCATT
NM_004573.2         ATGAAGGACTACATACCTGGTGCTTGGGCAGATCTCACTGTGGCCCTCGCCAACCCCATT
XM_005254450.1      ATGAAGGACTACATACCTGGTGCTTGGGCAGATCTCACTGTGGCCCTCGCCAACCCCATT
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ATGAAGGACTACATACCTGGTGCTTGGGCAGATCTCACTGTGGCCCTCGCCAACCCCATT
XM_005254449.1      ATGAAGGACTACATACCTGGTGCTTGGGCAGATCTCACTGTGGCCCTCGCCAACCCCATT
NM_001284297.1      ATGAAGGACTACATACCTGGTGCTTGGGCAGATCTCACTGTGGCCCTCGCCAACCCCATT
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AAGTTCTTCAGTGCCCATGACACGAAGTCTGTGAAGCTCAAGGAGGCCATGGGAGGTCTG
NM_004573.2         AAGTTCTTCAGTGCCCATGACACGAAGTCTGTGAAGCTCAAGGAGGCCATGGGAGGTCTG
XM_005254450.1      AAGTTCTTCAGTGCCCATGACACGAAGTCTGTGAAGCTCAAGGAGGCCATGGGAGGTCTG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AAGTTCTTCAGTGCCCATGACACGAAGTCTGTGAAGCTCAAGGAGGCCATGGGAGGTCTG
XM_005254449.1      AAGTTCTTCAGTGCCCATGACACGAAGTCTGTGAAGCTCAAGGAGGCCATGGGAGGTCTG
NM_001284297.1      AAGTTCTTCAGTGCCCATGACACGAAGTCTGTGAAGCTCAAGGAGGCCATGGGAGGTCTG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CCTGAGAAGCCCTTCCCACTGGCGAGTCCAGTTGCCAGCCAGGTCAATGGGGCGTTGGCC
NM_004573.2         CCTGAGAAGCCCTTCCCACTGGCGAGTCCAGTTGCCAGCCAGGTCAATGGGGCGTTGGCC
XM_005254450.1      CCTGAGAAGCCCTTCCCACTGGCGAGTCCAGTTGCCAGCCAGGTCAATGGGGCGTTGGCC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CCTGAGAAGCCCTTCCCACTGGCGAGTCCAGTTGCCAGCCAGGTCAATGGGGCGTTGGCC
XM_005254449.1      CCTGAGAAGCCCTTCCCACTGGCGAGTCCAGTTGCCAGCCAGGTCAATGGGGCGTTGGCC
NM_001284297.1      CCTGAGAAGCCCTTCCCACTGGCGAGTCCAGTTGCCAGCCAGGTCAATGGGGCGTTGGCC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CCAACGAGCAATGGGTCACCAGAG------------------------------------
NM_004573.2         CCAACGAGCAATGGGTCACCAGCAGCCAGGGCCGGGGCCAGGGAAGAGGCTATGAAAGAA
XM_005254450.1      CCAACGAGCAATGGGTCACCAGCAGCCAGGGCCGGGGCCAGGGAAGAGGCTATGAAAGAA
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CCAACGAGCAATGGGTCACCAGCAGCCAGGGCCGGGGCCAGGGAAGAGGCTATGAAAGAA
XM_005254449.1      CCAACGAGCAATGGGTCACCAGCAGCCAGGGCCGGGGCCAGGGAAGAGGCTATGAAAGAA
NM_001284297.1      CCAACGAGCAATGGGTCACCAGCAGCCAGGGCCGGGGCCAGGGAAGAGGCTATGAAAGAA
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      ---------CCGCGGACCGCCAGCCTGGAGGAGCTCCGGGAGCTAAAGGGCGTGGTGAAG
NM_004573.2         GCTGCGGAGCCGCGGACCGCCAGCCTGGAGGAGCTCCGGGAGCTAAAGGGCGTGGTGAAG
XM_005254450.1      GCTGCGGAGCCGCGGACCGCCAGCCTGGAGGAGCTCCGGGAGCTAAAGGGCGTGGTGAAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCTGCGGAGCCGCGGACCGCCAGCCTGGAGGAGCTCCGGGAGCTAAAGGGCGTGGTGAAG
XM_005254449.1      GCTGCGGAGCCGCGGACCGCCAGCCTGGAGGAGCTCCGGGAGCTAAAGGGCGTGGTGAAG
NM_001284297.1      GCTGCGGAGCCGCGGACCGCCAGCCTGGAGGAGCTCCGGGAGCTAAAGGGCGTGGTGAAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CTGCAGCGGCGGCACGAGAAGGAGCTGCGAGAGTTGGAGCGGCGCGGAGCGCGGCGCTGG
NM_004573.2         CTGCAGCGGCGGCACGAGAAGGAGCTGCGAGAGTTGGAGCGGCGCGGAGCGCGGCGCTGG
XM_005254450.1      CTGCAGCGGCGGCACGAGAAGGAGCTGCGAGAGTTGGAGCGGCGCGGAGCGCGGCGCTGG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CTGCAGCGGCGGCACGAGAAGGAGCTGCGAGAGTTGGAGCGGCGCGGAGCGCGGCGCTGG
XM_005254449.1      CTGCAGCGGCGGCACGAGAAGGAGCTGCGAGAGTTGGAGCGGCGCGGAGCGCGGCGCTGG
NM_001284297.1      CTGCAGCGGCGGCACGAGAAGGAGCTGCGAGAGTTGGAGCGGCGCGGAGCGCGGCGCTGG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GAGGAGCTGCTGCAGCGGGGCGCGGCGCAGCTGGCGGAGCTCGGGCCACCGGGCGTGGGG
NM_004573.2         GAGGAGCTGCTGCAGCGGGGCGCGGCGCAGCTGGCGGAGCTCGGGCCACCGGGCGTGGGG
XM_005254450.1      GAGGAGCTGCTGCAGCGGGGCGCGGCGCAGCTGGCGGAGCTCGGGCCACCGGGCGTGGGG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GAGGAGCTGCTGCAGCGGGGCGCGGCGCAGCTGGCGGAGCTCGGGCCACCGGGCGTGGGG
XM_005254449.1      GAGGAGCTGCTGCAGCGGGGCGCGGCGCAGCTGGCGGAGCTCGGGCCACCGGGCGTGGGG
NM_001284297.1      GAGGAGCTGCTGCAGCGGGGCGCGGCGCAGCTGGCGGAGCTCGGGCCACCGGGCGTGGGG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GGCGTCGGGGCCTGCAAGCTCGGTCCCGGCAAGGGCTCTCGCAAGAAGAGGAGCCTGCCC
NM_004573.2         GGCGTCGGGGCCTGCAAGCTCGGTCCCGGCAAGGGCTCTCGCAAGAAGAGGAGCCTGCCC
XM_005254450.1      GGCGTCGGGGCCTGCAAGCTCGGTCCCGGCAAGGGCTCTCGCAAGAAGAGGAGCCTGCCC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GGCGTCGGGGCCTGCAAGCTCGGTCCCGGCAAGGGCTCTCGCAAGAAGAGGAGCCTGCCC
XM_005254449.1      GGCGTCGGGGCCTGCAAGCTCGGTCCCGGCAAGGGCTCTCGCAAGAAGAGGAGCCTGCCC
NM_001284297.1      GGCGTCGGGGCCTGCAAGCTCGGTCCCGGCAAGGGCTCTCGCAAGAAGAGGAGCCTGCCC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CGCGAGGAGAGCGCCGGAGCCGCGCCGGGCGAGGGCCCTGAGGGCGTGGACGGGCGCGTG
NM_004573.2         CGCGAGGAGAGCGCCGGAGCCGCGCCGGGCGAGGGCCCTGAGGGCGTGGACGGGCGCGTG
XM_005254450.1      CGCGAGGAGAGCGCCGGAGCCGCGCCGGGCGAGGGCCCTGAGGGCGTGGACGGGCGCGTG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CGCGAGGAGAGCGCCGGAGCCGCGCCGGGCGAGGGCCCTGAGGGCGTGGACGGGCGCGTG
XM_005254449.1      CGCGAGGAGAGCGCCGGAGCCGCGCCGGGCGAGGGCCCTGAGGGCGTGGACGGGCGCGTG
NM_001284297.1      CGCGAGGAGAGCGCCGGAGCCGCGCCGGGCGAGGGCCCTGAGGGCGTGGACGGGCGCGTG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CGGGAGCTGAAAGACAGGCTGGAGCTGGAGCTGCTGCGGCAGGGCGAGGAGCAGTACGAG
NM_004573.2         CGGGAGCTGAAAGACAGGCTGGAGCTGGAGCTGCTGCGGCAGGGCGAGGAGCAGTACGAG
XM_005254450.1      CGGGAGCTGAAAGACAGGCTGGAGCTGGAGCTGCTGCGGCAGGGCGAGGAGCAGTACGAG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CGGGAGCTGAAAGACAGGCTGGAGCTGGAGCTGCTGCGGCAGGGCGAGGAGCAGTACGAG
XM_005254449.1      CGGGAGCTGAAAGACAGGCTGGAGCTGGAGCTGCTGCGGCAGGGCGAGGAGCAGTACGAG
NM_001284297.1      CGGGAGCTGAAAGACAGGCTGGAGCTGGAGCTGCTGCGGCAGGGCGAGGAGCAGTACGAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TGCGTTCTGAAGCGCAAGGAGCAGCACGTGGCCGAGCAAATCTCCAAAATGATGGAGCTG
NM_004573.2         TGCGTTCTGAAGCGCAAGGAGCAGCACGTGGCCGAGCAAATCTCCAAAATGATGGAGCTG
XM_005254450.1      TGCGTTCTGAAGCGCAAGGAGCAGCACGTGGCCGAGCAAATCTCCAAAATGATGGAGCTG
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      TGCGTTCTGAAGCGCAAGGAGCAGCACGTGGCCGAGCAAATCTCCAAAATGATGGAGCTG
XM_005254449.1      TGCGTTCTGAAGCGCAAGGAGCAGCACGTGGCCGAGCAAATCTCCAAAATGATGGAGCTG
NM_001284297.1      TGCGTTCTGAAGCGCAAGGAGCAGCACGTGGCCGAGCAAATCTCCAAAATGATGGAGCTG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCCAGAGAGAAACAGGCGGCAGAGCTGAAGGCCCTGAAGGAGACGTCGGAGAACGACACC
NM_004573.2         GCCAGAGAGAAACAGGCGGCAGAGCTGAAGGCCCTGAAGGAGACGTCGGAGAACGACACC
XM_005254450.1      GCCAGAGAGAAACAGGCGGCAGAGCTGAAGGCCCTGAAGGAGACGTCGGAGAACGACACC
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GCCAGAGAGAAACAGGCGGCAGAGCTGAAGGCCCTGAAGGAGACGTCGGAGAACGACACC
XM_005254449.1      GCCAGAGAGAAACAGGCGGCAGAGCTGAAGGCCCTGAAGGAGACGTCGGAGAACGACACC
NM_001284297.1      GCCAGAGAGAAACAGGCGGCAGAGCTGAAGGCCCTGAAGGAGACGTCGGAGAACGACACC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AAAGAGATGAAGAAAAAGCTGGAGACAAAGAGACTGGAGCGGATCCAGGGCATGACCAAA
NM_004573.2         AAAGAGATGAAGAAAAAGCTGGAGACAAAGAGACTGGAGCGGATCCAGGGCATGACCAAA
XM_005254450.1      AAAGAGATGAAGAAAAAGCTGGAGACAAAGAGACTGGAGCGGATCCAGGGCATGACCAAA
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      AAAGAGATGAAGAAAAAGCTGGAGACAAAGAGACTGGAGCGGATCCAGGGCATGACCAAA
XM_005254449.1      AAAGAGATGAAGAAAAAGCTGGAGACAAAGAGACTGGAGCGGATCCAGGGCATGACCAAA
NM_001284297.1      AAAGAGATGAAGAAAAAGCTGGAGACAAAGAGACTGGAGCGGATCCAGGGCATGACCAAA
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GTCACCACAGACAAGATGGCCCAGGAGAGGTTGAAGAGAGAGATTAACAACTCCCACATC
NM_004573.2         GTCACCACAGACAAGATGGCCCAGGAGAGGTTGAAGAGAGAGATTAACAACTCCCACATC
XM_005254450.1      GTCACCACAGACAAGATGGCCCAGGAGAGATGA---------------------------
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      GTCACCACAGACAAGATGGCCCAGGAGAGGTTGAAGAGAGAGATTAACAACTCCCACATC
XM_005254449.1      GTCACCACAGACAAGATGGCCCAGGAGAGGTTGAAGAGAGAGATTAACAACTCCCACATC
NM_001284297.1      GTCACCACAGACAAGATGGCCCAGGAGAGGTTGAAGAGAGAGATTAACAACTCCCACATC
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CAGGAAGTAGTGCAGGTGATCAAGCAGATGACGGAGAACTTGGAGAGGCACCAGGAGAAG
NM_004573.2         CAGGAAGTAGTGCAGGTGATCAAGCAGATGACGGAGAACTTGGAGAGGCACCAGGAGAAG
XM_005254450.1      ------------------------------------------------------------
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CAGGAAGTAGTGCAGGTGATCAAGCAGATGACGGAGAACTTGGAGAGGCACCAGGAGAAG
XM_005254449.1      CAGGAAGTAGTGCAGGTGATCAAGCAGATGACGGAGAACTTGGAGAGGCACCAGGAGAAG
NM_001284297.1      CAGGAAGTAGTGCAGGTGATCAAGCAGATGACGGAGAACTTGGAGAGGCACCAGGAGAAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      CTGGAGGAGAAGCAGGCGGCTTGCCTGGAACAGATACGGGAGATGGAAAAGCAGTTCCAG
NM_004573.2         CTGGAGGAGAAGCAGGCGGCTTGCCTGGAACAGATACGGGAGATGGAAAAGCAGTTCCAG
XM_005254450.1      ------------------------------------------------------------
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CTGGAGGAGAAGCAGGCGGCTTGCCTGGAACAGATACGGGAGATGGAAAAGCAGCCAGAT
XM_005254449.1      CTGGAGGAGAAGCAGGCGGCTTGCCTGGAACAGATACGGGAGATGGAAAAGCAGAACATA
NM_001284297.1      CTGGAGGAGAAGCAGGCGGCTTGCCTGGAACAGATACGGGAGATGGAAAAGCAGTTCCAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      AAGGAGGCGCTGGCAGAGTACGAGGCCAGGATGAAGGGTCTGGAGGCAGAGGTGAAGGAG
NM_004573.2         AAGGAGGCGCTGGCAGAGTACGAGGCCAGGATGAAGGGTCTGGAGGCAGAGGTGAAGGAG
XM_005254450.1      ------------------------------------------------------------
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      CCCGCACATCCTTGA---------------------------------------------
XM_005254449.1      CTGAGCCCATAG------------------------------------------------
NM_001284297.1      AAGGAGGCGCTGGCAGAGTACGAGGCCAGGATGAAGGGTCTGGAGGCAGAGGTGAAGGAG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      TCGGTGAGGGCCTGCCTCAGGACCTGCTTTCCCTCCGAGGCCAAGGACAAGCCTGAGAGG
NM_004573.2         TCGGTGAGGGCCTGCCTCAGGACCTGCTTTCCCTCCGAGGCCAAGGACAAGCCTGAGAGG
XM_005254450.1      ------------------------------------------------------------
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ------------------------------------------------------------
XM_005254449.1      ------------------------------------------------------------
NM_001284297.1      TCGGTGAGGGCCTGCCTCAGGACCTGCTTTCCCTCCGAGGCCAAGGACAAGCCTGAGAGG
                                                                                

HsCD00022200        ------------------------------------------------------------
NM_001284298.1      GCCTGCGAGTGCCCCCCAGAGCTGTGTGAGCAGGACCCACTCATAGCAAAGGCAGATGCC
NM_004573.2         GCCTGCGAGTGCCCCCCAGAGCTGTGTGAGCAGGACCCACTCATAGCAAAGGCAGATGCC
XM_005254450.1      ------------------------------------------------------------
NM_001284299.1      ------------------------------------------------------------
XM_005254448.1      ------------------------------------------------------------
XM_005254449.1      ------------------------------------------------------------
NM_001284297.1      GCCTGCGAGTGCCCCCCAGAGCTGTGTGAGCAGGACCCACTCATAGCAAAGGCAGATGCC
                                                                                

HsCD00022200        ------------------
NM_001284298.1      CAGGAGAGCCGCCTCTGA
NM_004573.2         CAGGAGAGCCGCCTCTGA
XM_005254450.1      ------------------
NM_001284299.1      ------------------
XM_005254448.1      ------------------
XM_005254449.1      ------------------
NM_001284297.1      CAGGAGAGCCGCCTCTGA
                                      

Pathways

NCI : Alpha-synuclein signaling
NCI : CXCR4-mediated signaling events
NCI : Endothelins
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : Nongenotropic Androgen signaling
NCI : PAR1-mediated thrombin signaling events
NCI : PAR4-mediated thrombin signaling events
NCI : Plasma membrane estrogen receptor signaling
NCI : RAC1 signaling pathway
NCI : S1P1 pathway
NCI : Thromboxane A2 receptor signaling
Panther : 2-arachidonoylglycerol biosynthesis
Panther : 5HT2 type receptor mediated signaling pathway
Panther : Alpha adrenergic receptor signaling pathway
Panther : Angiotensin II-stimulated signaling through G proteins and beta-arrestin
Panther : Endogenous cannabinoid signaling
Panther : Endothelin signaling pathway
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Histamine H1 receptor mediated signaling pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Oxytocin receptor mediated signaling pathway
Panther : Thyrotropin-releasing hormone receptor signaling pathway
Panther : Wnt signaling pathway
Reactome : Acetylcholine regulates insulin secretion
Reactome : Activation of Kainate Receptors upon glutamate binding
Reactome : Ca2+ pathway
Reactome : Fatty Acids bound to GPR40 (FFAR1) regulate insulin secretion
Reactome : Free fatty acids regulate insulin secretion
Reactome : G alpha (q) signalling events
Reactome : G beta:gamma signalling through PLC beta
Reactome : G-protein beta:gamma signalling
Reactome : G-protein mediated events
Reactome : GPCR downstream signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Inositol phosphate metabolism
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Opioid Signalling
Reactome : PLC beta mediated events
Reactome : Presynaptic function of Kainate receptors
Reactome : Regulation of insulin secretion
Reactome : Signal Transduction
Reactome : Signaling by GPCR
Reactome : Signaling by Wnt
Reactome : Synthesis of IP3 and IP4 in the cytosol
Reactome : Transmission across Chemical Synapses
Reactome : beta-catenin independent WNT signaling
WikiPathway : Alzheimers Disease
WikiPathway : MicroRNAs in cardiomyocyte hypertrophy
WikiPathway : Signal Transduction of S1P Receptor

Protein

UniProt : Q59F77
UniProt : Q00722
HPRD : 04985

Clone

Cloning Information : 23941
HIP Master Clone ID : 54317
Original Clone ID : FLH023941.01X

Organism


TAX_ID : 9606
Species Specific ID: 5330

Genome

Chromosome : 15
Map Location : 15q15
Ensembl : ENSG00000137841

Reagents

Labome : PLCB2-antibody