DNASU Plasmid Repository • 480.965.5697 | Email

PTPN11 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPN11
Gene Name:  protein tyrosine phosphatase, non-receptor type 11
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH023944.01L
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: Short variant or partial clone comparing to NM_002834
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00022201

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1383nts         Open reading frame : 1 to 1383
Reference Sequence Alignment

ATGACATCGCGGAGATGGTTTCACCCAAATATCACTGGTGTGGAGGCAGAAAACCTACTG
TTGACAAGAGGAGTTGATGGCAGTTTTTTGGCAAGGCCTAGTAAAAGTAACCCTGGAGAC
TTCACACTTTCCGTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGT
GATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTAT
TACATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATAT
CCTCTGAACTGTGCAGATCCTACCTCTGAAAGGTGGTTTCATGGACATCTCTCTGGGAAA
GAAGCAGAGAAATTATTAACTGAAAAAGGAAAACATGGTAGTTTTCTTGTACGAGAGAGC
CAGAGCCACCCTGGAGATTTTGTTCTTTCTGTGCGCACTGGTGATGACAAAGGGGAGAGC
AATGACGGCAAGTCTAAAGTGACCCATGTTATGATTCGCTGTCAGGAACTGAAATACGAC
GTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAACATTATAAGAAGAAT
CCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAGCCCCTTAACACGACTCGT
ATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGCAAATTAGCTGAGACCACA
GATAAAGTCAAACAAGGCTTTTGGGAAGAATTTGAGACACTACAACAACAGGAGTGCAAA
CTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAAAACAAAAACAAAAATAGATATAAA
AACATCCTGCCCTTTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCT
GTTTCAGATTACATCAATGCAAATATCATCATGCCCGAATTTGAAACCAAGTGCAACAAT
TCAAAGCCCAAAAAGAGTTACATTGCCACACAAGGCTGCCTGCAAAACACGGTGAATGAC
TTTTGGCGGATGGTGTTCCAAGAAAACTCCCGAGTGATTGTCATGACAACGAAAGAAGTG
GAGAGAGGAAAGAGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATAT
GGCGTCATGCGTGTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAA
CTTAAACTTTCAAAGGTTGGACAAGGGAATACGGAGAGAACGGTCTGGCAATACCACTTT
CGGACCTGGCCGGACCACGGCGTGCCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAG
GAGGTGCACCATAAGCAGGAGAGCATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAGG
TTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1586
Start on reference sequence 204
Mutations:
None
Discrepancy:
t936c
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPN11
Symbol Nomenclature : PTPN11
SYNONYM : BPTP3; CFC; NS1; PTP-1D; PTP2C; SH-PTP2; SH-PTP3; SHP2
Designation : PTP-2C|protein-tyrosine phosphatase 1D|protein-tyrosine phosphatase 2C|tyrosine-protein phosphatase non-receptor type 11
Full Nomenclature : protein tyrosine phosphatase, non-receptor type 11
GENEID : 5781
HGNC : 9644
MIM : 176876
Vega : OTTHUMG00000134334
Target GenBank: BC008692

 

Reference Sequence Alignment

  

HsCD00022201      ATGACATCGCGGAGATGGTTTCACCCAAATATCACTGGTGTGGAGGCAGAAAACCTACTG
NM_002834.3       ATGACATCGCGGAGATGGTTTCACCCAAATATCACTGGTGTGGAGGCAGAAAACCTACTG
NM_080601.1       ATGACATCGCGGAGATGGTTTCACCCAAATATCACTGGTGTGGAGGCAGAAAACCTACTG
                  ************************************************************

HsCD00022201      TTGACAAGAGGAGTTGATGGCAGTTTTTTGGCAAGGCCTAGTAAAAGTAACCCTGGAGAC
NM_002834.3       TTGACAAGAGGAGTTGATGGCAGTTTTTTGGCAAGGCCTAGTAAAAGTAACCCTGGAGAC
NM_080601.1       TTGACAAGAGGAGTTGATGGCAGTTTTTTGGCAAGGCCTAGTAAAAGTAACCCTGGAGAC
                  ************************************************************

HsCD00022201      TTCACACTTTCCGTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGT
NM_002834.3       TTCACACTTTCCGTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGT
NM_080601.1       TTCACACTTTCCGTTAGAAGAAATGGAGCTGTCACCCACATCAAGATTCAGAACACTGGT
                  ************************************************************

HsCD00022201      GATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTAT
NM_002834.3       GATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTAT
NM_080601.1       GATTACTATGACCTGTATGGAGGGGAGAAATTTGCCACTTTGGCTGAGTTGGTCCAGTAT
                  ************************************************************

HsCD00022201      TACATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATAT
NM_002834.3       TACATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATAT
NM_080601.1       TACATGGAACATCACGGGCAATTAAAAGAGAAGAATGGAGATGTCATTGAGCTTAAATAT
                  ************************************************************

HsCD00022201      CCTCTGAACTGTGCAGATCCTACCTCTGAAAGGTGGTTTCATGGACATCTCTCTGGGAAA
NM_002834.3       CCTCTGAACTGTGCAGATCCTACCTCTGAAAGGTGGTTTCATGGACATCTCTCTGGGAAA
NM_080601.1       CCTCTGAACTGTGCAGATCCTACCTCTGAAAGGTGGTTTCATGGACATCTCTCTGGGAAA
                  ************************************************************

HsCD00022201      GAAGCAGAGAAATTATTAACTGAAAAAGGAAAACATGGTAGTTTTCTTGTACGAGAGAGC
NM_002834.3       GAAGCAGAGAAATTATTAACTGAAAAAGGAAAACATGGTAGTTTTCTTGTACGAGAGAGC
NM_080601.1       GAAGCAGAGAAATTATTAACTGAAAAAGGAAAACATGGTAGTTTTCTTGTACGAGAGAGC
                  ************************************************************

HsCD00022201      CAGAGCCACCCTGGAGATTTTGTTCTTTCTGTGCGCACTGGTGATGACAAAGGGGAGAGC
NM_002834.3       CAGAGCCACCCTGGAGATTTTGTTCTTTCTGTGCGCACTGGTGATGACAAAGGGGAGAGC
NM_080601.1       CAGAGCCACCCTGGAGATTTTGTTCTTTCTGTGCGCACTGGTGATGACAAAGGGGAGAGC
                  ************************************************************

HsCD00022201      AATGACGGCAAGTCTAAAGTGACCCATGTTATGATTCGCTGTCAGGAACTGAAATACGAC
NM_002834.3       AATGACGGCAAGTCTAAAGTGACCCATGTTATGATTCGCTGTCAGGAACTGAAATACGAC
NM_080601.1       AATGACGGCAAGTCTAAAGTGACCCATGTTATGATTCGCTGTCAGGAACTGAAATACGAC
                  ************************************************************

HsCD00022201      GTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAACATTATAAGAAGAAT
NM_002834.3       GTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAACATTATAAGAAGAAT
NM_080601.1       GTTGGTGGAGGAGAACGGTTTGATTCTTTGACAGATCTTGTGGAACATTATAAGAAGAAT
                  ************************************************************

HsCD00022201      CCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAGCCCCTTAACACGACTCGT
NM_002834.3       CCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAGCCCCTTAACACGACTCGT
NM_080601.1       CCTATGGTGGAAACATTGGGTACAGTACTACAACTCAAGCAGCCCCTTAACACGACTCGT
                  ************************************************************

HsCD00022201      ATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGCAAATTAGCTGAGACCACA
NM_002834.3       ATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGCAAATTAGCTGAGACCACA
NM_080601.1       ATAAATGCTGCTGAAATAGAAAGCAGAGTTCGAGAACTAAGCAAATTAGCTGAGACCACA
                  ************************************************************

HsCD00022201      GATAAAGTCAAACAAGGCTTTTGGGAAGAATTTGAGACACTACAACAACAGGAGTGCAAA
NM_002834.3       GATAAAGTCAAACAAGGCTTTTGGGAAGAATTTGAGACACTACAACAACAGGAGTGCAAA
NM_080601.1       GATAAAGTCAAACAAGGCTTTTGGGAAGAATTTGAGACACTACAACAACAGGAGTGCAAA
                  ************************************************************

HsCD00022201      CTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAAAACAAAAACAAAAATAGATATAAA
NM_002834.3       CTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAAAACAAAAACAAAAATAGATATAAA
NM_080601.1       CTTCTCTACAGCCGAAAAGAGGGTCAAAGGCAAGAAAACAAAAACAAAAATAGATATAAA
                  ************************************************************

HsCD00022201      AACATCCTGCCCTTTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCT
NM_002834.3       AACATCCTGCCCTTTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCT
NM_080601.1       AACATCCTGCCCTTTGATCATACCAGGGTTGTCCTACACGATGGTGATCCCAATGAGCCT
                  ************************************************************

HsCD00022201      GTTTCAGATTACATCAATGCAAATATCATCATGCCCGAATTTGAAACCAAGTGCAACAAT
NM_002834.3       GTTTCAGATTACATCAATGCAAATATCATCATGCCTGAATTTGAAACCAAGTGCAACAAT
NM_080601.1       GTTTCAGATTACATCAATGCAAATATCATCATGCCTGAATTTGAAACCAAGTGCAACAAT
                  *********************************** ************************

HsCD00022201      TCAAAGCCCAAAAAGAGTTACATTGCCACACAAGGCTGCCTGCAAAACACGGTGAATGAC
NM_002834.3       TCAAAGCCCAAAAAGAGTTACATTGCCACACAAGGCTGCCTGCAAAACACGGTGAATGAC
NM_080601.1       TCAAAGCCCAAAAAGAGTTACATTGCCACACAAGGCTGCCTGCAAAACACGGTGAATGAC
                  ************************************************************

HsCD00022201      TTTTGGCGGATGGTGTTCCAAGAAAACTCCCGAGTGATTGTCATGACAACGAAAGAAGTG
NM_002834.3       TTTTGGCGGATGGTGTTCCAAGAAAACTCCCGAGTGATTGTCATGACAACGAAAGAAGTG
NM_080601.1       TTTTGGCGGATGGTGTTCCAAGAAAACTCCCGAGTGATTGTCATGACAACGAAAGAAGTG
                  ************************************************************

HsCD00022201      GAGAGAGGAAAGAGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATAT
NM_002834.3       GAGAGAGGAAAGAGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATAT
NM_080601.1       GAGAGAGGAAAGAGTAAATGTGTCAAATACTGGCCTGATGAGTATGCTCTAAAAGAATAT
                  ************************************************************

HsCD00022201      GGCGTCATGCGTGTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAA
NM_002834.3       GGCGTCATGCGTGTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAA
NM_080601.1       GGCGTCATGCGTGTTAGGAACGTCAAAGAAAGCGCCGCTCATGACTATACGCTAAGAGAA
                  ************************************************************

HsCD00022201      CTTAAACTTTCAAAGGTTGGACAAGGGAATACGGAGAGAACGGTCTGGCAATACCACTTT
NM_002834.3       CTTAAACTTTCAAAGGTTGGACAAGGGAATACGGAGAGAACGGTCTGGCAATACCACTTT
NM_080601.1       CTTAAACTTTCAAAGGTTGGACAAGGGAATACGGAGAGAACGGTCTGGCAATACCACTTT
                  ************************************************************

HsCD00022201      CGGACCTGGCCGGACCACGGCGTGCCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAG
NM_002834.3       CGGACCTGGCCGGACCACGGCGTGCCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAG
NM_080601.1       CGGACCTGGCCGGACCACGGCGTGCCCAGCGACCCTGGGGGCGTGCTGGACTTCCTGGAG
                  ************************************************************

HsCD00022201      GAGGTGCACCATAAGCAGGAGAGCATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAGG
NM_002834.3       GAGGTGCACCATAAGCAGGAGAGCATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAGT
NM_080601.1       GAGGTGCACCATAAGCAGGAGAGCATCATGGATGCAGGGCCGGTCGTGGTGCACTGCAGG
                  *********************************************************** 

HsCD00022201      TTG---------------------------------------------------------
NM_002834.3       GCTGGAATTGGCCGGACAGGGACGTTCATTGTGATTGATATTCTTATTGACATCATCAGA
NM_080601.1       TGA---------------------------------------------------------
                                                                              

HsCD00022201      ------------------------------------------------------------
NM_002834.3       GAGAAAGGTGTTGACTGCGATATTGACGTTCCCAAAACCATCCAGATGGTGCGGTCTCAG
NM_080601.1       ------------------------------------------------------------
                                                                              

HsCD00022201      ------------------------------------------------------------
NM_002834.3       AGGTCAGGGATGGTCCAGACAGAAGCACAGTACCGATTTATCTATATGGCGGTCCAGCAT
NM_080601.1       ------------------------------------------------------------
                                                                              

HsCD00022201      ------------------------------------------------------------
NM_002834.3       TATATTGAAACACTACAGCGCAGGATTGAAGAAGAGCAGAAAAGCAAGAGGAAAGGGCAC
NM_080601.1       ------------------------------------------------------------
                                                                              

HsCD00022201      ------------------------------------------------------------
NM_002834.3       GAATATACAAATATTAAGTATTCTCTAGCGGACCAGACGAGTGGAGATCAGAGCCCTCTC
NM_080601.1       ------------------------------------------------------------
                                                                              

HsCD00022201      ------------------------------------------------------------
NM_002834.3       CCGCCTTGTACTCCAACGCCACCCTGTGCAGAAATGAGAGAAGACAGTGCTAGAGTCTAT
NM_080601.1       ------------------------------------------------------------
                                                                              

HsCD00022201      ------------------------------------------
NM_002834.3       GAAAACGTGGGCCTGATGCAACAGCAGAAAAGTTTCAGATGA
NM_080601.1       ------------------------------------------
                                                            

Pathways

NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : CXCR4-mediated signaling events
NCI : EGF receptor (ErbB1) signaling pathway
NCI : EPO signaling pathway
NCI : ErbB2/ErbB3 signaling events
NCI : FGF signaling pathway
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : GMCSF-mediated signaling events
NCI : IFN-gamma pathway
NCI : IGF1 pathway
NCI : IL2 signaling events mediated by PI3K
NCI : IL2 signaling events mediated by STAT5
NCI : IL2-mediated signaling events
NCI : IL3-mediated signaling events
NCI : IL5-mediated signaling events
NCI : IL6-mediated signaling events
NCI : Insulin Pathway
NCI : Integrins in angiogenesis
NCI : N-cadherin signaling events
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-beta signaling pathway
NCI : SHP2 signaling
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by Stem cell factor receptor (c-Kit)
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : TCR signaling in naïve CD4+ T cells
NCI : VEGFR1 specific signals
Reactome : Activated TLR4 signalling
Reactome : Activation of IRF3/IRF7 mediated by TBK1/IKK epsilon
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : GAB1 signalosome
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interferon Signaling
Reactome : Interferon alpha/beta signaling
Reactome : Interferon gamma signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : Interleukin-6 signaling
Reactome : MyD88-independent cascade
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Negative regulation of FGFR signaling
Reactome : Netrin mediated repulsion signals
Reactome : Netrin-1 signaling
Reactome : Nuclear signaling by ERBB4
Reactome : PD-1 signaling
Reactome : PECAM1 interactions
Reactome : PI-3K cascade
Reactome : PI3K Cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet homeostasis
Reactome : Platelet sensitization by LDL
Reactome : Prolactin receptor signaling
Reactome : Regulation of IFNA signaling
Reactome : Regulation of IFNG signaling
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : Signal Transduction
Reactome : Signal regulatory protein (SIRP) family interactions
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Spry regulation of FGF signaling
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Tie2 Signaling
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Alpha 6 Beta 4 signaling pathway
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Heart Development
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : IL-5 signaling pathway
WikiPathway : IL-6 signaling pathway
WikiPathway : Insulin Signaling
WikiPathway : Kit receptor signaling pathway
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : Proteins and DNA Sequences in Cardicac Structures
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : Type II interferon signaling (IFNG)
WikiPathway : angiogenesis overview

Clone

Cloning Information : 23944
HIP Master Clone ID : 54320
Original Clone ID : FLH023944.01L

Organism


TAX_ID : 9606
Species Specific ID: 5781

Genome

Chromosome : 12
Map Location : 12q24
Ensembl : ENSG00000179295

Reagents

Labome : SHP-2-antibody