DNASU Plasmid Repository • 480.965.5697 | Email

MTX1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  MTX1
Gene Name:  metaxin 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110615.01L
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: Short variant or partial clone comparing to NM_002455
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00022239

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 861nts         Open reading frame : 1 to 861
Reference Sequence Alignment

ATGGCGGCGCCCATGGAGCTGTTCTGCTGGTCAGGGGGCTGGGGGCTGCCGTCAGTGGAC
CTGGACAGCCTGGCCGTGCTGACCTATGCCAGATTTACTGGTGCTCCACTGAAGGTACAC
AAGATCAGCAACCCCTGGCAGAGCCCTTCAGGAACTCTGCCTGCCCTTCGGACCAGTCAT
GGAGAGGTCATCTCAGTTCCACACAAGATCATCACCCACCTTCGAAAAGAGGTACATACT
TTTTGGATAGACACCAAGAACTACGTGGAAGTGACCCGGAAGTGGTATGCAGAGGCTATG
CCCTTTCCCCTCAACTTCTTCCTGCCTGGCCGCATGCAGCGGCAGTACATGGAACGGCTA
CAGCTGCTGACTGGGGAGCACAGGCCTGAGGACGAGGAAGAGCTGGAGAAGGAGCTGTAC
CGAGAGGCTCGGGAGTGTCTGACCCTGCTCTCTCAGCGCCTGGGCTCTCAAAAGTTCTTC
TTTGGAGATGCCCCTGCCTCCTTGGACGCCTTCGTCTTCAGCTACTTGGCCCTGCTGCTG
CAGGCAAAGCTGCCCAGTGGGAAGCTGCAGGTCCACCTGCGTGGGCTGCACAACCTCTGT
GCCTATTGTACCCACATTCTCAGTCTCTACTTCCCCTGGGATGGAGCTGAGGTACCACCG
CAACGCCAGACACCAGCAGGCCCAGAGACTGAGGAGGAGCCATACCGGCGCCGGAACCAG
ATCCTATCTGTGCTGGCAGGACTGGCAGCCATGGTGGGCTACGCCTTGCTCAGCGGCATT
GTCTCCATCCAGCGGGCAACGCCTGCTCGGGCCCCAGGCACCCGGACCCTGGGCATGGCT
GAGGAGGATGAAGAGGAATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1316
Start on reference sequence 9
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : MTX1
Symbol Nomenclature : MTX1
SYNONYM : MTX; MTXN
Designation : metaxin-1|mitochondrial outer membrane import complex protein 1
Full Nomenclature : metaxin 1
GENEID : 4580
Locus Tag : RP11-263K19.5
HGNC : 7504
MIM : 600605
Vega : OTTHUMG00000035708
Target GenBank: BC001906

 

Reference Sequence Alignment

  

HsCD00022239      ------------------------------------------------------------
NM_002455.3       ATGCTGCTCGGGGGACCCCCCCGCAGTCCCCGCTCGGGGACGAGCCCCAAGGGGCCCTGG
NM_198883.2       ATGCTGCTCGGGGGACCCCCCCGCAGTCCCCGCTCGGGGACGAGCCCCAAGGGGCCCTGG
                                                                              

HsCD00022239      ------------------------------------------------------------
NM_002455.3       AGCAGTACAGGCCACGTGCAGTTTGGCAAGAGCCCCCAGACCTGGCCCAGGCGCACAAGA
NM_198883.2       AGCAGTACAGGCCACGTGCAGTTTGGCAAGAGCCCCCAGACCTGGCCCAGGCGCACAAGA
                                                                              

HsCD00022239      ------------------------------------------------------------
NM_002455.3       CCCCGCTCTCCAGAGCCTGCCGCGCCTTCAGGGGTTCGGGGCTCCACTTGGACGAGGCGC
NM_198883.2       CCCCGCTCTCCAGAGCCTGCCGCGCCTTCAGGGGTTCGGGGCTCCACTTGGACGAGGCGC
                                                                              

HsCD00022239      ------------------------------------------------------------
NM_002455.3       CGTGACACTCCGAGGCGCGCCGGGCCGACAGCGCTGTCCCGCTACGTGGGCCACCTCTGG
NM_198883.2       CGTGACACTCCGAGGCGCGCCGGGCCGACAGCGCTGTCCCGCTACGTGGGCCACCTCTGG
                                                                              

HsCD00022239      ------------------------------------------------------------
NM_002455.3       ATGGGCCGGCGGCCGCCCTCCCCCGAGGCCCGCGGCCCAGTCCCCCGCAGTTCAGCTGCC
NM_198883.2       ATGGGCCGGCGGCCGCCCTCCCCCGAGGCCCGCGGCCCAGTCCCCCGCAGTTCAGCTGCC
                                                                              

HsCD00022239      ------------------------------------------------------------
NM_002455.3       AGTCGGGCCAGAAGAAGCCTCGCCTCCCCGGGGATCTCCCCAGGCCCCCTGACCGCAACG
NM_198883.2       AGTCGGGCCAGAAGAAGCCTCGCCTCCCCGGGGATCTCCCCAGGCCCCCTGACCGCAACG
                                                                              

HsCD00022239      ------------------------------------------------------------
NM_002455.3       ATCGGAGGGGCGGTGGCGGGGGGCGGGCCCAGGCAGGGGAGGGCAGAAGCACACAAGGAA
NM_198883.2       ATCGGAGGGGCGGTGGCGGGGGGCGGGCCCAGGCAGGGGAGGGCAGAAGCACACAAGGAA
                                                                              

HsCD00022239      ---------------------------ATGGCGGCGCCCATGGAGCTGTTCTGCTGGTCA
NM_002455.3       GTGTTTCCGGGACAGAGGGTGGGCAAGATGGCGGCGCCCATGGAGCTGTTCTGCTGGTCA
NM_198883.2       GTGTTTCCGGGACAGAGGGTGGGCAAGATGGCGGCGCCCATGGAGCTGTTCTGCTGGTCA
                                             *********************************

HsCD00022239      GGGGGCTGGGGGCTGCCGTCAGTGGACCTGGACAGCCTGGCCGTGCTGACCTATGCCAGA
NM_002455.3       GGGGGCTGGGGGCTGCCGTCAGTGGACCTGGACAGCCTGGCCGTGCTGACCTATGCCAGA
NM_198883.2       GGGGGCTGGGGGCTGCCGTCAGTGGACCTGGACAGCCTGGCCGTGCTGACCTATGCCAGA
                  ************************************************************

HsCD00022239      TTTACTGGTGCTCCACTGAAGGTACACAAGATCAGCAACCCCTGGCAGAGCCCTTCAGGA
NM_002455.3       TTTACTGGTGCTCCACTGAAGGTACACAAGATCAGCAACCCCTGGCAGAGCCCTTCAGGA
NM_198883.2       TTTACTGGTGCTCCACTGAAGGTACACAAGATCAGCAACCCCTGGCAGAGCCCTTCAGGA
                  ************************************************************

HsCD00022239      ACTCTGCCTGCCCTTCGGACCAGTCATGGAGAGGTCATCTCAGTTCCACACAAGATCATC
NM_002455.3       ACTCTGCCTGCCCTTCGGACCAGTCATGGAGAGGTCATCTCAGTTCCACACAAGATCATC
NM_198883.2       ACTCTGCCTGCCCTTCGGACCAGTCATGGAGAGGTCATCTCAGTTCCACACAAGATCATC
                  ************************************************************

HsCD00022239      ACCCACCTTCGAAAAGAGGT----------------------------------------
NM_002455.3       ACCCACCTTCGAAAAGA--GAAGTACAATGCTGATTATGATCTGTCAGCTCGGCAAGGGG
NM_198883.2       ACCCACCTTCGAAAAGA--GGT--------------------------------------
                  *****************                                           

HsCD00022239      -------------------------------------------------------ACATA
NM_002455.3       CAGACACCCTGGCCTTCATGTCTCTCCTGGAGGAGAAGTTGCTCCCGGTGCTGGTACATA
NM_198883.2       -------------------------------------------------------ACATA
                                                                         *****

HsCD00022239      CTTTTTGGATAGACACCAAGAACTACGTGGAAGTGACCCGGAAGTGGTATGCAGAGGCTA
NM_002455.3       CTTTTTGGATAGACACCAAGAACTACGTGGAAGTGACCCGGAAGTGGTATGCAGAGGCTA
NM_198883.2       CTTTTTGGATAGACACCAAGAACTACGTGGAAGTGACCCGGAAGTGGTATGCAGAGGCTA
                  ************************************************************

HsCD00022239      TGCCCTTTCCCCTCAACTTCTTCCTGCCTGGCCGCATGCAGCGGCAGTACATGGAACGGC
NM_002455.3       TGCCCTTTCCCCTCAACTTCTTCCTGCCTGGCCGCATGCAGCGGCAGTACATGGAACGGC
NM_198883.2       TGCCCTTTCCCCTCAACTTCTTCCTGCCTGGCCGCATGCAGCGGCAGTACATGGAACGGC
                  ************************************************************

HsCD00022239      TACAGCTGCTGACTGGGGAGCACAGGCCTGAGGACGAGGAAGAGCTGGAGAAGGAGCTGT
NM_002455.3       TACAGCTGCTGACTGGGGAGCACAGGCCTGAGGACGAGGAAGAGCTGGAGAAGGAGCTGT
NM_198883.2       TACAGCTGCTGACTGGGGAGCACAGGCCTGAGGACGAGGAAGAGCTGGAGAAGGAGCTGT
                  ************************************************************

HsCD00022239      ACCGAGAGGCTCGGGAGTGTCTGACCCTGCTCTCTCAGCGCCTGGGCTCTCAAAAGTTCT
NM_002455.3       ACCGAGAGGCTCGGGAGTGTCTGACCCTGCTCTCTCAGCGCCTGGGCTCTCAAAAGTTCT
NM_198883.2       ACCGAGAGGCTCGGGAGTGTCTGACCCTGCTCTCTCAGCGCCTGGGCTCTCAAAAGTTCT
                  ************************************************************

HsCD00022239      TCTTTGGAGATGCCCCTGCCTCCTTGGACGCCTTCGTCTTCAGCTACTTGGCCCTGCTGC
NM_002455.3       TCTTTGGAGATGCCCCTGCCTCCTTGGACGCCTTCGTCTTCAGCTACTTGGCCCTGCTGC
NM_198883.2       TCTTTGGAGATGCCCCTGCCTCCTTGGACGCCTTCGTCTTCAGCTACTTGGCCCTGCTGC
                  ************************************************************

HsCD00022239      TGCAGGCAAAGCTGCCCAGTGGGAAGCTGCAGGTCCACCTGCGTGGGCTGCACAACCTCT
NM_002455.3       TGCAGGCAAAGCTGCCCAGTGGGAAGCTGCAGGTCCACCTGCGTGGGCTGCACAACCTCT
NM_198883.2       TGCAGGCAAAGCTGCCCAGTGGGAAGCTGCAGGTCCACCTGCGTGGGCTGCACAACCTCT
                  ************************************************************

HsCD00022239      GTGCCTATTGTACCCACATTCTCAGTCTCTACTTCCCCTGGGATGGAGCTGAGGTACCAC
NM_002455.3       GTGCCTATTGTACCCACATTCTCAGTCTCTACTTCCCCTGGGATGGAGCTGAGGTACCAC
NM_198883.2       GTGCCTATTGTACCCACATTCTCAGTCTCTACTTCCCCTGGGATGGAGCTGAGGTACCAC
                  ************************************************************

HsCD00022239      CGCAACGCCAGACACCAGCAGGCCCAGAGACTGAGGAGGAGCCATACCGGCGCCGGAACC
NM_002455.3       CGCAACGCCAGACACCAGCAGGCCCAGAGACTGAGGAGGAGCCATACCGGCGCCGGAACC
NM_198883.2       CGCAACGCCAGACACCAGCAGGCCCAGAGACTGAGGAGGAGCCATACCGGCGCCGGAACC
                  ************************************************************

HsCD00022239      AGATCCTATCTGTGCTGGCAGGACTGGCAGCCATGGTGGGCTACGCCTTGCTCAGCGGCA
NM_002455.3       AGATCCTATCTGTGCTGGCAGGACTGGCAGCCATGGTGGGCTACGCCTTGCTCAGCGGCA
NM_198883.2       AGATCCTATCTGTGCTGGCAGGACTGGCAGCCATGGTGGGCTACGCCTTGCTCAGCGGCA
                  ************************************************************

HsCD00022239      TTGTCTCCATCCAGCGGGCAACGCCTGCTCGGGCCCCAGGCACCCGGACCCTGGGCATGG
NM_002455.3       TTGTCTCCATCCAGCGGGCAACGCCTGCTCGGGCCCCAGGCACCCGGACCCTGGGCATGG
NM_198883.2       TTGTCTCCATCCAGCGGGCAACGCCTGCTCGGGCCCCAGGCACCCGGACCCTGGGCATGG
                  ************************************************************

HsCD00022239      CTGAGGAGGATGAAGAGGAATTG
NM_002455.3       CTGAGGAGGATGAAGAGGAATGA
NM_198883.2       CTGAGGAGGATGAAGAGGAATGA
                  ********************* .

Pathways

Reactome : Metabolism of proteins
Reactome : Mitochondrial protein import
WikiPathway : Epithelium TarBase
WikiPathway : Lymphocyte TarBase

Protein

UniProt : Q13505
HPRD : 11861

Clone

Cloning Information : 110615
HIP Master Clone ID : 86961
Original Clone ID : FLH110615.01L

Organism


TAX_ID : 9606
Species Specific ID: 4580

Genome

Chromosome : 1
Map Location : 1q21
Ensembl : ENSG00000173171

Reagents

Labome : MTX1-antibody