DNASU Plasmid Repository • 480.965.5697 | Email

CAMK2B (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CAMK2B
Gene Name:  calcium/calmodulin-dependent protein kinase II beta
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH147929.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00022345

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1512nts         Open reading frame : 1 to 1512
Reference Sequence Alignment

ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGCAGCCAAGAGTTTA
CTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAAAACAGTGCAGCC
GCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGTCTTCTGACAGTGCCAAT
ACCACCATAGAGGATGAAGACGCTAAAGCCCGGAAGCAGGAGATCATTAAGACCACGGAG
CAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATCTGTGACCCA
GGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATGGACTTCCAC
AGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACGACCATCCTG
AACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATCCGGCTCACG
CAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACCCGCGTGTGG
CACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCGCCTGTGGCC
CCGCTGCAGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1675
Start on reference sequence 47
Mutations:
None
Discrepancy:
del@946,72; del@1134,45
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CAMK2B
Symbol Nomenclature : CAMK2B
SYNONYM : CAM2; CAMK2; CAMKB
Designation : CaM kinase II beta subunit|CaM-kinase II beta chain|caMK-II subunit beta|calcium/calmodulin-dependent protein kinase type II subunit beta|proline rich calmodulin-dependent protein kinase
Full Nomenclature : calcium/calmodulin-dependent protein kinase II beta
GENEID : 816
GI : 61368968
GenBank Accession : AY891338
HGNC : 1461
MIM : 607707
Vega : OTTHUMG00000023491
Target GenBank: NM_001220

 

Reference Sequence Alignment

  

HsCD00022345        ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_001220.4         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
XM_005249861.1      ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172080.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172078.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172081.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172079.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
NM_172083.2         ATGGCCACCACGGTGACCTGCACCCGCTTCACCGACGAGTACCAGCTCTACGAGGATATT
                    ************************************************************

HsCD00022345        GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_001220.4         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
XM_005249861.1      GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172080.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172078.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172081.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172079.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
NM_172083.2         GGCAAGGGGGCTTTCTCTGTGGTCCGACGCTGTGTCAAGCTCTGCACCGGCCATGAGTAT
                    ************************************************************

HsCD00022345        GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_001220.4         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
XM_005249861.1      GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172080.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172078.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172081.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172079.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
NM_172083.2         GCAGCCAAGATCATCAACACCAAGAAGCTGTCAGCCAGAGATCACCAGAAGCTGGAGAGA
                    ************************************************************

HsCD00022345        GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_001220.4         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
XM_005249861.1      GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172080.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172078.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172081.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172079.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
NM_172083.2         GAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATC
                    ************************************************************

HsCD00022345        TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_001220.4         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
XM_005249861.1      TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172080.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172078.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172081.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172079.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
NM_172083.2         TCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAA
                    ************************************************************

HsCD00022345        GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_001220.4         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
XM_005249861.1      GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172080.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172078.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172081.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172079.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
NM_172083.2         GACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATC
                    ************************************************************

HsCD00022345        CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_001220.4         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
XM_005249861.1      CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172080.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172078.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172081.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172079.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
NM_172083.2         CTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAG
                    ************************************************************

HsCD00022345        AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_001220.4         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
XM_005249861.1      AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172080.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172078.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172081.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172079.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
NM_172083.2         AACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTA
                    ************************************************************

HsCD00022345        GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_001220.4         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
XM_005249861.1      GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172080.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172078.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172081.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172079.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
NM_172083.2         GCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTAC
                    ************************************************************

HsCD00022345        CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_001220.4         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
XM_005249861.1      CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172080.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172078.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172081.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172079.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
NM_172083.2         CTGTCCCCTGAGGTCCTTCGCAAAGAGGCGTATGGCAAGCCTGTGGACATCTGGGCATGT
                    ************************************************************

HsCD00022345        GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_001220.4         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
XM_005249861.1      GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172080.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172078.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172081.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172079.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
NM_172083.2         GGGGTGATCCTGTACATCCTGCTCGTGGGCTACCCACCCTTCTGGGACGAGGACCAGCAC
                    ************************************************************

HsCD00022345        AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_001220.4         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
XM_005249861.1      AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172080.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172078.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172081.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172079.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
NM_172083.2         AAGCTGTACCAGCAGATCAAGGCTGGTGCCTATGACTTCCCGTCCCCTGAGTGGGACACC
                    ************************************************************

HsCD00022345        GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_001220.4         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
XM_005249861.1      GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172080.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172078.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172081.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172079.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
NM_172083.2         GTCACTCCTGAAGCCAAAAACCTCATCAACCAGATGCTGACCATCAACCCTGCCAAGCGC
                    ************************************************************

HsCD00022345        ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_001220.4         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
XM_005249861.1      ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172080.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172078.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172081.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172079.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
NM_172083.2         ATCACAGCCCATGAGGCCCTGAAGCACCCGTGGGTCTGCCAACGCTCCACGGTAGCATCC
                    ************************************************************

HsCD00022345        ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_001220.4         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
XM_005249861.1      ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172080.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172078.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172081.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172079.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
NM_172083.2         ATGATGCACAGACAGGAGACTGTGGAGTGTCTGAAAAAGTTCAATGCCAGGAGAAAGCTC
                    ************************************************************

HsCD00022345        AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_001220.4         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
XM_005249861.1      AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
NM_172080.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_172078.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAGTGGGCAGACAGACC
NM_172081.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_172079.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
NM_172083.2         AAGGGAGCCATCCTCACCACCATGCTGGCCACACGGAATTTCTCAG--------------
                    **********************************************              

HsCD00022345        ----------------------------------------------------------CA
NM_001220.4         ACCGCTCCGGCCACAATGTCCACCGCGGCCTCCGGCACCACCATGGGGCTGGTGGAACAA
XM_005249861.1      ACCGCTCCGGCCACAATGTCCACCGCGGCCTCCGGCACCACCATGGGGCTGGTGGAACAA
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ACCGCTCCGGCCACAATGTCCACCGCGGCCTCCGGCACCACCATGGGGCTGGTGGAACAA
NM_172081.2         ----------------------------------------------------------CA
NM_172079.2         ----------------------------------------------------------CA
NM_172083.2         ----------------------------------------------------------CA
                                                                                

HsCD00022345        GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_001220.4         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
XM_005249861.1      GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172080.2         -CCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172078.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172081.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172079.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATGGAGTCAAGCCCCAGACGAATAGCACCAAA
NM_172083.2         GCCAAGAGTTTACTCAACAAGAAAGCAGATG-----------------------------
                     ******************************                             

HsCD00022345        AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTG---------
NM_001220.4         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
XM_005249861.1      AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172080.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172078.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172081.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTG---------
NM_172079.2         AACAGTGCAGCCGCCACCAGCCCCAAAGGGACGCTTCCTCCTGCCGCCCTGGAGCCTCAA
NM_172083.2         -------------------------------------------GAGTCAAG---------
                                                                .* *.:*         

HsCD00022345        ------------------------------------GAGTCTTCTGACAGTGCCAATACC
NM_001220.4         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
XM_005249861.1      ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172080.2         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172078.2         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172081.2         ------------------------------------GAGTCTTCTGACAGTGCCAATACC
NM_172079.2         ACCACCGTCATCCATAACCCAGTGGACGGGATTAAGGAGTCTTCTGACAGTGCCAATACC
NM_172083.2         ------------------------------------GAGTCTTCTGACAGTGCCAATACC
                                                        ************************

HsCD00022345        ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_001220.4         ACCATAGAGGATGAAGACGCTAAAGCCCCCAGGGTCCCCGACATCCTGAGCTCAGTGAGG
XM_005249861.1      ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172080.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172078.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172081.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172079.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
NM_172083.2         ACCATAGAGGATGAAGACGCTAAAGCCCGGAAG---------------------------
                    ****************************  *.*                           

HsCD00022345        ------------------------------------------------------------
NM_001220.4         AGGGGCTCGGGAGCCCCAGAAGCCGAGGGGCCCCTGCCCTGCCCATCTCCGGCTCCCTTT
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00022345        ------------------------------------------------------------
NM_001220.4         AGCCCCCTGCCAGCCCCATCCCCCAGGATCTCTGACATCCTGAACTCTGTGAGAAGGGGT
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00022345        ------------------------------------------------------------
NM_001220.4         TCAGGAACCCCAGAAGCCGAGGGCCCCCTCTCAGCGGGGCCCCCGCCCTGCCTGTCTCCG
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00022345        ------------------------------------------------------------
NM_001220.4         GCTCTCCTAGGCCCCCTGTCCTCCCCGTCCCCCAGGATCTCTGACATCCTGAACTCTGTG
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00022345        ------------------------------------------------------------
NM_001220.4         AGGAGGGGCTCAGGGACCCCAGAAGCCGAGGGCCCCTCGCCAGTGGGGCCCCCGCCCTGC
XM_005249861.1      ------------------------------------------------------------
NM_172080.2         ------------------------------------------------------------
NM_172078.2         ------------------------------------------------------------
NM_172081.2         ------------------------------------------------------------
NM_172079.2         ------------------------------------------------------------
NM_172083.2         ------------------------------------------------------------
                                                                                

HsCD00022345        ---------------------------------------------CAGGAGATCATTAAG
NM_001220.4         CCATCTCCGACTATCCCTGGCCCCCTGCCCACCCCATCCCGGAAGCAGGAGATCATTAAG
XM_005249861.1      ---------------------------------------------CAGGAGATCATTAAG
NM_172080.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172078.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172081.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172079.2         ---------------------------------------------CAGGAGATCATTAAG
NM_172083.2         ---------------------------------------------CAGGAGATCATTAAG
                                                                 ***************

HsCD00022345        ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_001220.4         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
XM_005249861.1      ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172080.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172078.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172081.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172079.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
NM_172083.2         ACCACGGAGCAGCTCATCGAGGCCGTCAACAACGGTGACTTTGAGGCCTACGCGAAAATC
                    ************************************************************

HsCD00022345        TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_001220.4         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
XM_005249861.1      TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172080.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172078.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172081.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172079.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
NM_172083.2         TGTGACCCAGGGCTGACCTCGTTTGAGCCTGAAGCACTGGGCAACCTGGTTGAAGGGATG
                    ************************************************************

HsCD00022345        GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_001220.4         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
XM_005249861.1      GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172080.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172078.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172081.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172079.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
NM_172083.2         GACTTCCACAGATTCTACTTCGAGAACCTGCTGGCCAAGAACAGCAAGCCGATCCACACG
                    ************************************************************

HsCD00022345        ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_001220.4         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
XM_005249861.1      ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172080.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172078.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172081.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172079.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
NM_172083.2         ACCATCCTGAACCCACACGTGCACGTCATTGGAGAGGATGCCGCCTGCATCGCTTACATC
                    ************************************************************

HsCD00022345        CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_001220.4         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
XM_005249861.1      CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172080.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172078.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172081.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172079.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
NM_172083.2         CGGCTCACGCAGTACATTGACGGGCAGGGCCGGCCCCGCACCAGCCAGTCTGAGGAGACC
                    ************************************************************

HsCD00022345        CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_001220.4         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
XM_005249861.1      CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172080.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172078.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172081.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172079.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
NM_172083.2         CGCGTGTGGCACCGCCGCGACGGCAAGTGGCAGAACGTGCACTTCCACTGCTCGGGCGCG
                    ************************************************************

HsCD00022345        CCTGTGGCCCCGCTGCAGTTG
NM_001220.4         CCTGTGGCCCCGCTGCAGTGA
XM_005249861.1      CCTGTGGCCCCGCTGCAGTGA
NM_172080.2         CCTGTGGCCCCGCTGCAGTGA
NM_172078.2         CCTGTGGCCCCGCTGCAGTGA
NM_172081.2         CCTGTGGCCCCGCTGCAGTGA
NM_172079.2         CCTGTGGCCCCGCTGCAGTGA
NM_172083.2         CCTGTGGCCCCGCTGCAGTGA
                    ******************* .

Pathways

NCI : IFN-gamma pathway
NCI : Regulation of Ras family activation
NCI : p38 MAPK signaling pathway
Panther : Ionotropic glutamate receptor pathway
Reactome : Activation of NMDA receptor upon glutamate binding and postsynaptic events
Reactome : CREB phosphorylation through the activation of CaMKII
Reactome : CREB phosphorylation through the activation of Ras
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : Cytokine Signaling in Immune system
Reactome : Glutamate Binding, Activation of AMPA Receptors and Synaptic Plasticity
Reactome : HSF1-dependent transactivation
Reactome : Immune System
Reactome : Interferon Signaling
Reactome : Interferon gamma signaling
Reactome : Neuronal System
Reactome : Neurotransmitter Receptor Binding And Downstream Transmission In The Postsynaptic Cell
Reactome : Post NMDA receptor activation events
Reactome : Ras activation uopn Ca2+ infux through NMDA receptor
Reactome : Trafficking of AMPA receptors
Reactome : Transmission across Chemical Synapses
Reactome : Unblocking of NMDA receptor, glutamate binding and activation
WikiPathway : Calcium Regulation in the Cardiac Cell
WikiPathway : Hypothetical Network for Drug Addiction
WikiPathway : Myometrial Relaxation and Contraction Pathways

Clone

Cloning Information : 147929
HIP Master Clone ID : 124248
Original Clone ID : FLH147929.01L

Organism


TAX_ID : 9606
Species Specific ID: 816

Genome

Chromosome : 7
Map Location : 7p14.3-p14.1
Ensembl : ENSG00000058404

Reagents

Labome : CAMK2B-antibody