DNASU Plasmid Repository • 480.965.5697 | Email

SLK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLK
Gene Name:  STE20-like kinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH163302.01F
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00022368

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 3615nts         Open reading frame : 1 to 3615
Reference Sequence Alignment

ATGTCCTTCTTCAATTTCCGTAAGATCTTCAAGTTGGGGAGCGAGAAGAAGAAGAAGCAG
TACGAACACGTGAAGAGGGACCTGAACCCCGAAGACTTTTGGGAGATTATAGGAGAACTG
GGCGACGGAGCCTTTGGGAAAGTGTACAAGGCCCAGAATAAAGAGACCAGTGTTTTAGCT
GCTGCAAAAGTGATTGACACTAAATCTGAAGAAGAACTTGAAGATTACATGGTAGAGATT
GACATATTAGCATCTTGTGATCACCCAAATATAGTCAAGCTTCTAGATGCCTTCTATTAT
GAGAACAATCTTTGGATCCTCATTGAATTTTGTGCAGGTGGAGCAGTAGATGCTGTGATG
CTTGAACTTGAGAGACCATTAACTGAGTCCCAAATACAAGTAGTTTGCAAGCAGACTTTA
GATGCATTGAACTACTTACATGATAATAAGATCATCCACAGAGATCTGAAGGCTGGCAAC
ATTCTCTTTACCTTAGATGGAGATATCAAATTGGCGGATTTTGGAGTATCAGCTAAAAAC
ATGAGGACAATTCAAAGAAGAGATTCCTTTATTGGTACACCATATTGGATGGCTCCTGAA
GTAGTCATGTGTGAAACATCTAAGGACAGACCCTATGACTACAAAGCTGATGTTTGGTCC
CTGGGTATCACTTTAATAGAAATGGCTGAGATAGAACCACCTCATCATGAATTAAATCCA
ATGCGAGTGCTGCTAAAAATAGCAAAATCTGAGCCACCTACATTAGCACAGCCATCCAGA
TGGTCTTCAAATTTTAAGGACTTTCTAAAGAAATGCTTAGAAAAGAATGTGGATGCCAGG
TGGACTACATCTCAGCTGCTGCAGCATCCCTTTGTTACTGTTGATTCCAACAAACCCATC
CGAGAATTGATTGCAGAGGCGAAGGCTGAAGTAACAGAAGAAGTTGAAGATGGCAAAGAG
GAAGATGAAGAGGAGGAAACAGAAAATTCTCTGCCAATACCTGCAAGTAAGCGTGCATCT
TCTGACCTTAGTATCGCCAGCTCTGAAGAAGATAAACTTTCACAAAATGCTTGTATTTTG
GAGTCTGTCTCAGAAAAAACAGAACGTAGTAACTCTGAAGATAAACTCAACAGCAAAATT
CTTAATGAAAAACCCACCACTGATGAACCTGAAAAGGCTGTGGAGGATATTAATGAACAT
ATTACCGATGCTCAGTTAGAAGCAATGACTGAACTCCATGACAGAACAGCAGTAATCAAG
GAGAATGAAAGAGAGAAGAGGCCCAAGCTTGAAAATCTGCCTGACACAGAAGACCAAGAA
ACTGTGGACATTAATTCAGTCAGTGAAGGAAAAGAGAATAATATAATGATAACCTTAGAA
ACAAATATTGAACATAATCTAAAATCTGAGGAAGAAAAGGATCAGGAAAAGCAACAGATG
TTTGAAAATAAGCTTATAAAATCTGAAGAAATTAAAGATACTATTTTGCAAACAGTAGAT
TTAGTTTCTCAAGAGACTGGAGAAAAAGAGGCAAATATTCAGGCAGTTGATAGTGAAGTT
GGGCTTACAAAGGAAGACACCCAAGAGAAATTGGGGGAAGACGACAAAACTCAAAAAGAT
GTGATCAGCAATACAAGTGATGTGATAGGAACATATGAGGCAGCAGATGTGGCTCAGAAA
GTGGATGAAGACAGTGCTGAGGATACGCAGAGTAATGATGGGAAAGAAGTGGTCGAAGTA
GGCCAGAAATTAATTAATAAGCCCATGGTGGGTCCTGAGGCTGGTGGTACTAAGGAAGTT
CCTATTAAAGAAATAGTTGAAATGAATGAAATAGAAGAAGGTAAAAATAAGGAACAAGCA
ATAAACAGTTCAGAGAACATAATGGACATCAATGAGGAACCAGGAACAACTGAAGGTGAA
GAAATCACTGAGTCAAGTAGCACTGAAGAAATGGAGGTCAGAAGTGTGGTGGCTGATACT
GACCAAAAGGCTTTAGGAAGTGAAGTTCAGGATGCTTCTAAAGTCACTACTCAGATAGAT
AAAGAGAAAAAAGAAATTCCAGTGTCAATTAAAAAAGAGCCTGAAGTTACTGTAGTTTCA
CAGCCCACTGAACCTCAGCCTGTTCTAATACCCAGTATTAATATCAACTCTGACAGTGGA
GAAAATAAAGAAGAAATAGGTTCTTTATCAAAAACTGAAACTATTCTGCCACCAGAATCT
GAGAATCCAAAGGAAAATGATAATGATTCAGGCACTGGTTCCACTGCTGATACTAGCAGT
ATTGACTTGAATTTATCCATCTCTAGCTTTCTAAGTAAAACTAAAGACAGTGGATCGATA
TCTTTACAAGAAACAAGAAGACAAAAGAAAACATTGAAGAAAACACGCAAATTTATTGTT
GATGGTGTAGAAGTGAGTGTAACAACATCAAAGATAGTTACAGATAGTGATTCCAAAACT
GAAGAATTGCGGTTTCTTAGACGTCAGGAACTTCGGGAATTAAGATTTCTTCAGAAAGAA
GAGCAAAGAGCCCAACAACAGCTCAATAGCAAACTACAGCAACAACGAGAACAAATTTTC
CGGCGCTTTGAGCAGGAAATGATGAGTAAAAAGCGACAATATGACCAGGAAATTGAGAAT
CTAGAAAAACAGCAGAAACAGACTATCGAACACCTGGAACAAGAGCACACAAATCGCTTG
CGAGATGAAGCCAAACGCATCAAAGGAGAACAAGAGAAAGAGTTGTCCAAATTTCAGAAT
ATGCTGAAGAACCGAAAGAAGGAGGAACAAGAGTTTGTTCAGAAACAACAGCAAGAATTA
GATGGCTCTCTGAAAAAGATCATCCAGCAGCAGAAGGCAGAGTTAGCTAATATTGAGAGA
GAGTGCCTGAATAACAAGCAACAGCTCATGAGAGCTCGAGAAGCTGCAATTTGGGAGCTC
GAAGAACGACACTTACAAGAAAAACACCAGCTGCTCAAACAGCAGCTTAAAGATCAGTAT
TTCATGCAAAGACATCAGCTACTTAAGCGCCACGAGAAGGAAACAGAGCAAATGCAGCGT
TACAATCAAAGACTTATTGAGGAATTGAAAAACAGACAGACTCAAGAAAGAGCAAGACTG
CCCAAGATTCAGCGCAGTGAAGCCAAGACTCGAATGGCCATGTTTAAGAAGAGTTTGAGA
ATTAACTCAACAGCCACACCAGATCAGGACCGTGATAAAATTAAACAGTTTGCTGCACAA
GAAGAAAAGAGGCAGAAAAATGAGAGAATGGCTCAGCATCAGAAACATGAGAATCAAATG
CGAGATCTTCAGTTGCAGTGTGAAGCCAATGTCCGCGAACTGCATCAGCTGCAGAATGAA
AAATGCCACTTGTTGGTTGAGCATGAGACTCAGAAACTGAAGGAGTTAGATGAGGAACAT
AGCCAAGAATTAAAGGAGTGGAGAGAGAAATTGAGACCTAGGAAAAAGACACTGGAAGAA
GAGTTTGCCAGGAAACTACAGGAACAGGAAGTATTCTTTAAAATGACTGGGGAGTCTGAA
TGCCTTAACCCATCAACACAGAGCCGGATTTCCAAATTTTATCCTATTCCCAGCTTGCAT
TCCACCGGATCATTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 3847
Start on reference sequence 233
Mutations:
None
Discrepancy:
c542t,T181M; t1626c;
 g1655a,C552Y; g2672a,R891H
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLK
Symbol Nomenclature : SLK
SYNONYM : LOSK; STK2; bA16H23.1; se20-9
Designation : CTCL tumor antigen se20-9|Long Ste20-like Kinase|SNF1 (sucrose nonfermenting, yeast, homolog)-like kinase, SNF1 sucrose nonfermenting like kinase|SNF1 sucrose nonfermenting like kinase|STE20-like serine/threonine-protein kinase|STE20-related kinase|STE20-related serine/threonine-protein kinase|Ste20-related serine/threonine kinase|hSLK|serine/threonine-protein kinase 2
Full Nomenclature : STE20-like kinase
GENEID : 9748
HGNC : 11088
Vega : OTTHUMG00000018999
Target GenBank: AB002804

 

Reference Sequence Alignment

  

HsCD00022368        ATGTCCTTCTTCAATTTCCGTAAGATCTTCAAGTTGGGGAGCGAGAAGAAGAAGAAGCAG
XM_005270301.1      ATGTCCTTCTTCAATTTCCGTAAGATCTTCAAGTTGGGGAGCGAGAAGAAGAAGAAGCAG
NM_014720.2         ATGTCCTTCTTCAATTTCCGTAAGATCTTCAAGTTGGGGAGCGAGAAGAAGAAGAAGCAG
                    ************************************************************

HsCD00022368        TACGAACACGTGAAGAGGGACCTGAACCCCGAAGACTTTTGGGAGATTATAGGAGAACTG
XM_005270301.1      TACGAACACGTGAAGAGGGACCTGAACCCCGAAGACTTTTGGGAGATTATAGGAGAACTG
NM_014720.2         TACGAACACGTGAAGAGGGACCTGAACCCCGAAGACTTTTGGGAGATTATAGGAGAACTG
                    ************************************************************

HsCD00022368        GGCGACGGAGCCTTTGGGAAAGTGTACAAGGCCCAGAATAAAGAGACCAGTGTTTTAGCT
XM_005270301.1      GGCGACGGAGCCTTTGGGAAAGTGTACAAGGCCCAGAATAAAGAGACCAGTGTTTTAGCT
NM_014720.2         GGCGACGGAGCCTTTGGGAAAGTGTACAAGGCCCAGAATAAAGAGACCAGTGTTTTAGCT
                    ************************************************************

HsCD00022368        GCTGCAAAAGTGATTGACACTAAATCTGAAGAAGAACTTGAAGATTACATGGTAGAGATT
XM_005270301.1      GCTGCAAAAGTGATTGACACTAAATCTGAAGAAGAACTTGAAGATTACATGGTAGAGATT
NM_014720.2         GCTGCAAAAGTGATTGACACTAAATCTGAAGAAGAACTTGAAGATTACATGGTAGAGATT
                    ************************************************************

HsCD00022368        GACATATTAGCATCTTGTGATCACCCAAATATAGTCAAGCTTCTAGATGCCTTCTATTAT
XM_005270301.1      GACATATTAGCATCTTGTGATCACCCAAATATAGTCAAGCTTCTAGATGCCTTCTATTAT
NM_014720.2         GACATATTAGCATCTTGTGATCACCCAAATATAGTCAAGCTTCTAGATGCCTTCTATTAT
                    ************************************************************

HsCD00022368        GAGAACAATCTTTGGATCCTCATTGAATTTTGTGCAGGTGGAGCAGTAGATGCTGTGATG
XM_005270301.1      GAGAACAATCTTTGGATCCTCATTGAATTTTGTGCAGGTGGAGCAGTAGATGCTGTGATG
NM_014720.2         GAGAACAATCTTTGGATCCTCATTGAATTTTGTGCAGGTGGAGCAGTAGATGCTGTGATG
                    ************************************************************

HsCD00022368        CTTGAACTTGAGAGACCATTAACTGAGTCCCAAATACAAGTAGTTTGCAAGCAGACTTTA
XM_005270301.1      CTTGAACTTGAGAGACCATTAACTGAGTCCCAAATACAAGTAGTTTGCAAGCAGACTTTA
NM_014720.2         CTTGAACTTGAGAGACCATTAACTGAGTCCCAAATACAAGTAGTTTGCAAGCAGACTTTA
                    ************************************************************

HsCD00022368        GATGCATTGAACTACTTACATGATAATAAGATCATCCACAGAGATCTGAAGGCTGGCAAC
XM_005270301.1      GATGCATTGAACTACTTACATGATAATAAGATCATCCACAGAGATCTGAAGGCTGGCAAC
NM_014720.2         GATGCATTGAACTACTTACATGATAATAAGATCATCCACAGAGATCTGAAGGCTGGCAAC
                    ************************************************************

HsCD00022368        ATTCTCTTTACCTTAGATGGAGATATCAAATTGGCGGATTTTGGAGTATCAGCTAAAAAC
XM_005270301.1      ATTCTCTTTACCTTAGATGGAGATATCAAATTGGCGGATTTTGGAGTATCAGCTAAAAAC
NM_014720.2         ATTCTCTTTACCTTAGATGGAGATATCAAATTGGCGGATTTTGGAGTATCAGCTAAAAAC
                    ************************************************************

HsCD00022368        ATGAGGACAATTCAAAGAAGAGATTCCTTTATTGGTACACCATATTGGATGGCTCCTGAA
XM_005270301.1      ACGAGGACAATTCAAAGAAGAGATTCCTTTATTGGTACACCATATTGGATGGCTCCTGAA
NM_014720.2         ACGAGGACAATTCAAAGAAGAGATTCCTTTATTGGTACACCATATTGGATGGCTCCTGAA
                    * **********************************************************

HsCD00022368        GTAGTCATGTGTGAAACATCTAAGGACAGACCCTATGACTACAAAGCTGATGTTTGGTCC
XM_005270301.1      GTAGTCATGTGTGAAACATCTAAGGACAGACCCTATGACTACAAAGCTGATGTTTGGTCC
NM_014720.2         GTAGTCATGTGTGAAACATCTAAGGACAGACCCTATGACTACAAAGCTGATGTTTGGTCC
                    ************************************************************

HsCD00022368        CTGGGTATCACTTTAATAGAAATGGCTGAGATAGAACCACCTCATCATGAATTAAATCCA
XM_005270301.1      CTGGGTATCACTTTAATAGAAATGGCTGAGATAGAACCACCTCATCATGAATTAAATCCA
NM_014720.2         CTGGGTATCACTTTAATAGAAATGGCTGAGATAGAACCACCTCATCATGAATTAAATCCA
                    ************************************************************

HsCD00022368        ATGCGAGTGCTGCTAAAAATAGCAAAATCTGAGCCACCTACATTAGCACAGCCATCCAGA
XM_005270301.1      ATGCGAGTGCTGCTAAAAATAGCAAAATCTGAGCCACCTACATTAGCACAGCCATCCAGA
NM_014720.2         ATGCGAGTGCTGCTAAAAATAGCAAAATCTGAGCCACCTACATTAGCACAGCCATCCAGA
                    ************************************************************

HsCD00022368        TGGTCTTCAAATTTTAAGGACTTTCTAAAGAAATGCTTAGAAAAGAATGTGGATGCCAGG
XM_005270301.1      TGGTCTTCAAATTTTAAGGACTTTCTAAAGAAATGCTTAGAAAAGAATGTGGATGCCAGG
NM_014720.2         TGGTCTTCAAATTTTAAGGACTTTCTAAAGAAATGCTTAGAAAAGAATGTGGATGCCAGG
                    ************************************************************

HsCD00022368        TGGACTACATCTCAGCTGCTGCAGCATCCCTTTGTTACTGTTGATTCCAACAAACCCATC
XM_005270301.1      TGGACTACATCTCAGCTGCTGCAGCATCCCTTTGTTACTGTTGATTCCAACAAACCCATC
NM_014720.2         TGGACTACATCTCAGCTGCTGCAGCATCCCTTTGTTACTGTTGATTCCAACAAACCCATC
                    ************************************************************

HsCD00022368        CGAGAATTGATTGCAGAGGCGAAGGCTGAAGTAACAGAAGAAGTTGAAGATGGCAAAGAG
XM_005270301.1      CGAGAATTGATTGCAGAGGCGAAGGCTGAAGTAACAGAAGAAGTTGAAGATGGCAAAGAG
NM_014720.2         CGAGAATTGATTGCAGAGGCGAAGGCTGAAGTAACAGAAGAAGTTGAAGATGGCAAAGAG
                    ************************************************************

HsCD00022368        GAAGATGAAGAGGAGGAAACAGAAAATTCTCTGCCAATACCTGCAAGTAAGCGTGCATCT
XM_005270301.1      GAAGATGAAGAGGAGGAAACAGAAAATTCTCTGCCAATACCTGCAAGTAAGCGTGCATCT
NM_014720.2         GAAGATGAAGAGGAGGAAACAGAAAATTCTCTGCCAATACCTGCAAGTAAGCGTGCATCT
                    ************************************************************

HsCD00022368        TCTGACCTTAGTATCGCCAGCTCTGAAGAAGATAAACTTTCACAAAATGCTTGTATTTTG
XM_005270301.1      TCTGACCTTAGTATCGCCAGCTCTGAAGAAGATAAACTTTCACAAAATGCTTGTATTTTG
NM_014720.2         TCTGACCTTAGTATCGCCAGCTCTGAAGAAGATAAACTTTCACAAAATGCTTGTATTTTG
                    ************************************************************

HsCD00022368        GAGTCTGTCTCAGAAAAAACAGAACGTAGTAACTCTGAAGATAAACTCAACAGCAAAATT
XM_005270301.1      GAGTCTGTCTCAGAAAAAACAGAACGTAGTAACTCTGAAGATAAACTCAACAGCAAAATT
NM_014720.2         GAGTCTGTCTCAGAAAAAACAGAACGTAGTAACTCTGAAGATAAACTCAACAGCAAAATT
                    ************************************************************

HsCD00022368        CTTAATGAAAAACCCACCACTGATGAACCTGAAAAGGCTGTGGAGGATATTAATGAACAT
XM_005270301.1      CTTAATGAAAAACCCACCACTGATGAACCTGAAAAGGCTGTGGAGGATATTAATGAACAT
NM_014720.2         CTTAATGAAAAACCCACCACTGATGAACCTGAAAAGGCTGTGGAGGATATTAATGAACAT
                    ************************************************************

HsCD00022368        ATTACCGATGCTCAGTTAGAAGCAATGACTGAACTCCATGACAGAACAGCAGTAATCAAG
XM_005270301.1      ATTACCGATGCTCAGTTAGAAGCAATGACTGAACTCCATGACAGAACAGCAGTAATCAAG
NM_014720.2         ATTACCGATGCTCAGTTAGAAGCAATGACTGAACTCCATGACAGAACAGCAGTAATCAAG
                    ************************************************************

HsCD00022368        GAGAATGAAAGAGAGAAGAGGCCCAAGCTTGAAAATCTGCCTGACACAGAAGACCAAGAA
XM_005270301.1      GAGAATGAAAGAGAGAAGAGGCCCAAGCTTGAAAATCTGCCTGACACAGAAGACCAAGAA
NM_014720.2         GAGAATGAAAGAGAGAAGAGGCCCAAGCTTGAAAATCTGCCTGACACAGAAGACCAAGAA
                    ************************************************************

HsCD00022368        ACTGTGGACATTAATTCAGTCAGTGAAGGAAAAGAGAATAATATAATGATAACCTTAGAA
XM_005270301.1      ACTGTGGACATTAATTCAGTCAGTGAAGGAAAAGAGAATAATATAATGATAACCTTAGAA
NM_014720.2         ACTGTGGACATTAATTCAGTCAGTGAAGGAAAAGAGAATAATATAATGATAACCTTAGAA
                    ************************************************************

HsCD00022368        ACAAATATTGAACATAATCTAAAATCTGAGGAAGAAAAGGATCAGGAAAAGCAACAGATG
XM_005270301.1      ACAAATATTGAACATAATCTAAAATCTGAGGAAGAAAAGGATCAGGAAAAGCAACAGATG
NM_014720.2         ACAAATATTGAACATAATCTAAAATCTGAGGAAGAAAAGGATCAGGAAAAGCAACAGATG
                    ************************************************************

HsCD00022368        TTTGAAAATAAGCTTATAAAATCTGAAGAAATTAAAGATACTATTTTGCAAACAGTAGAT
XM_005270301.1      TTTGAAAATAAGCTTATAAAATCTGAAGAAATTAAAGATACTATTTTGCAAACAGTAGAT
NM_014720.2         TTTGAAAATAAGCTTATAAAATCTGAAGAAATTAAAGATACTATTTTGCAAACAGTAGAT
                    ************************************************************

HsCD00022368        TTAGTTTCTCAAGAGACTGGAGAAAAAGAGGCAAATATTCAGGCAGTTGATAGTGAAGTT
XM_005270301.1      TTAGTTTCTCAAGAGACTGGAGAAAAAGAGGCAAATATTCAGGCAGTTGATAGTGAAGTT
NM_014720.2         TTAGTTTCTCAAGAGACTGGAGAAAAAGAGGCAAATATTCAGGCAGTTGATAGTGAAGTT
                    ************************************************************

HsCD00022368        GGGCTTACAAAGGAAGACACCCAAGAGAAATTGGGGGAAGACGACAAAACTCAAAAAGAT
XM_005270301.1      GGGCTTACAAAGGAAGACACCCAAGAGAAATTGGGGGAAGACGACAAAACTCAAAAAGAT
NM_014720.2         GGGCTTACAAAGGAAGACACCCAAGAGAAATTGGGGGAAGACGACAAAACTCAAAAAGAT
                    ************************************************************

HsCD00022368        GTGATCAGCAATACAAGTGATGTGATAGGAACATATGAGGCAGCAGATGTGGCTCAGAAA
XM_005270301.1      GTGATCAGCAATACAAGTGATGTGATAGGAACATGTGAGGCAGCAGATGTGGCTCAGAAA
NM_014720.2         GTGATCAGCAATACAAGTGATGTGATAGGAACATGTGAGGCAGCAGATGTGGCTCAGAAA
                    **********************************.*************************

HsCD00022368        GTGGATGAAGACAGTGCTGAGGATACGCAGAGTAATGATGGGAAAGAAGTGGTCGAAGTA
XM_005270301.1      GTGGATGAAGACAGTGCTGAGGATACGCAGAGTAATGATGGGAAAGAAGTGGTCGAAGTA
NM_014720.2         GTGGATGAAGACAGTGCTGAGGATACGCAGAGTAATGATGGGAAAGAAGTGGTCGAAGTA
                    ************************************************************

HsCD00022368        GGCCAGAAATTAATTAATAAGCCCATGGTGGGTCCTGAGGCTGGTGGTACTAAGGAAGTT
XM_005270301.1      GGCCAGAAATTAATTAATAAGCCCATGGTGGGTCCTGAGGCTGGTGGTACTAAGGAAGTT
NM_014720.2         GGCCAGAAATTAATTAATAAGCCCATGGTGGGTCCTGAGGCTGGTGGTACTAAGGAAGTT
                    ************************************************************

HsCD00022368        CCTATTAAAGAAATAGTTGAAATGAATGAAATAGAAGAAGGTAAAAATAAGGAACAAGCA
XM_005270301.1      CCTATTAAAGAAATAGTTGAAATGAATGAAATAGAAGAAGGTAAAAATAAGGAACAAGCA
NM_014720.2         CCTATTAAAGAAATAGTTGAAATGAATGAAATAGAAGAAGGTAAAAATAAGGAACAAGCA
                    ************************************************************

HsCD00022368        ATAAACAGTTCAGAGAACATAATGGACATCAATGAGGAACCAGGAACAACTGAAGGTGAA
XM_005270301.1      ATAAACAGTTCAGAGAACATAATGGACATCAATGAGGAACCAGGAACAACTGAAGGTGAA
NM_014720.2         ATAAACAGTTCAGAGAACATAATGGACATCAATGAGGAACCAGGAACAACTGAAGGTGAA
                    ************************************************************

HsCD00022368        GAAATCACTGAGTCAAGTAGCACTGAAGAAATGGAGGTCAGAAGTGTGGTGGCTGATACT
XM_005270301.1      GAAATCACTGAGTCAAGTAGCACTGAAGAAATGGAGGTCAGAAGTGTGGTGGCTGATACT
NM_014720.2         GAAATCACTGAGTCAAGTAGCACTGAAGAAATGGAGGTCAGAAGTGTGGTGGCTGATACT
                    ************************************************************

HsCD00022368        GACCAAAAGGCTTTAGGAAGTGAAGTTCAGGATGCTTCTAAAGTCACTACTCAGATAGAT
XM_005270301.1      GACCAAAAGGCTTTAGGAAGTGAAGTTCAGGATGCTTCTAAAGTCACTACTCAGATAGAT
NM_014720.2         GACCAAAAGGCTTTAGGAAGTGAAGTTCAGGATGCTTCTAAAGTCACTACTCAGATAGAT
                    ************************************************************

HsCD00022368        AAAGAGAAAAAAGAAATTCCAGTGTCAATTAAAAAAGAGCCTGAAGTTACTGTAGTTTCA
XM_005270301.1      AAAGAGAAAAAAGAAATTCCAGTGTCAATTAAAAAAGAGCCTGAAGTTACTGTAGTTTCA
NM_014720.2         AAAGAGAAAAAAGAAATTCCAGTGTCAATTAAAAAAGAGCCTGAAGTTACTGTAGTTTCA
                    ************************************************************

HsCD00022368        CAGCCCACTGAACCTCAGCCTGTTCTAATACCCAGTATTAATATCAACTCTGACAGTGGA
XM_005270301.1      CAGCCCACTGAACCTCAGCCTGTTCTAATACCCAGTATTAATATCAACTCTGACAGTGGA
NM_014720.2         CAGCCCACTGAACCTCAGCCTGTTCTAATACCCAGTATTAATATCAACTCTGACAGTGGA
                    ************************************************************

HsCD00022368        GAAAATAAAGAAGAAATAGGTTCTTTATCAAAAACTGAAACTATTCTGCCACCAGAATCT
XM_005270301.1      GAAAATAAAGAAGAAATAGGTTCTTTATCAAAAACTGAAACTATTCTGCCACCAGAATCT
NM_014720.2         GAAAATAAAGAAGAAATAGGTTCTTTATCAAAAACTGAAACTATTCTGCCACCAGAATCT
                    ************************************************************

HsCD00022368        GAGAATCCAAAGGAAAATGATAATGATTCAGGCACTGGTTCCACTGCTGATACTAGCAGT
XM_005270301.1      GAGAATCCAAAGGAAAATGATAATGATTCAGGCACTGGTTCCACTGCTGATACTAGCAGT
NM_014720.2         GAGAATCCAAAGGAAAATGATAATGATTCAGGCACTGGTTCCACTGCTGATACTAGCAGT
                    ************************************************************

HsCD00022368        ATTGACTTGAATTTATCCATCTCTAGCTTTCTAAGTAAAACTAAAGACAGTGGATCGATA
XM_005270301.1      ATTGACTTGAATTTATCCATCTCTAGCTTTCTAAGTAAAACTAAAGACAGTGGATCGATA
NM_014720.2         ATTGACTTGAATTTATCCATCTCTAGCTTTCTAAGTAAAACTAAAGACAGTGGATCGATA
                    ************************************************************

HsCD00022368        TCTTTACAAGAAACAAGAAGACAAAAGAAAACATTGAAGAAAACACGCAAATTTATTGTT
XM_005270301.1      TCTTTACAAGAAACAAGAAGACAAAAGAAAACATTGAAGAAAACACGCAAATTTATTGTT
NM_014720.2         TCTTTACAAGAAACAAGAAGACAAAAGAAAACATTGAAGAAAACACGCAAATTTATTGTT
                    ************************************************************

HsCD00022368        GATGGTGTAGAAGTGAGTGTAACAACATCAAAGATAGTTACAGATAGTGATTCCAAAACT
XM_005270301.1      GATGGTGTAGAAGTGAGTGTAACAACATCAAAGATAGTTACAGATAGTGATTCCAAAACT
NM_014720.2         GATGGTGTAGAAGTGAGTGTAACAACATCAAAGATAGTTACAGATAGTGATTCCAAAACT
                    ************************************************************

HsCD00022368        GAAGAATTGCGGTTTCTTAGACGTCAGGAACTTCGGGAATTAAGATTTCTTCAGAAAGAA
XM_005270301.1      GAAGAATTGCGGTTTCTTAGACGTCAGGAACTTCGGGAATTAAGATTTCTTCAGAAAGAA
NM_014720.2         GAAGAATTGCGGTTTCTTAGACGTCAGGAACTTCGGGAATTAAGATTTCTTCAGAAAGAA
                    ************************************************************

HsCD00022368        GAGCAAAGAGCCCAACAACAGCTCAATAGCAAACTACAGCAACAACGAGAACAAATTTTC
XM_005270301.1      GAGCAAAGAGCCCAACAACAGCTCAATAGCAAACTACAGCAACAACGAGAACAAATTTTC
NM_014720.2         GAGCAAAGAGCCCAACAACAGCTCAATAGCAAACTACAGCAACAACGAGAACAAATTTTC
                    ************************************************************

HsCD00022368        CGGCGCTTTGAGCAGGAAATGATGAGTAAAAAGCGACAATATGACCAGGAAATTGAGAAT
XM_005270301.1      CGGCGCTTTGAGCAGGAAATGATGAGTAAAAAGCGACAATATGACCAGGAAATTGAGAAT
NM_014720.2         CGGCGCTTTGAGCAGGAAATGATGAGTAAAAAGCGACAATATGACCAGGAAATTGAGAAT
                    ************************************************************

HsCD00022368        CTAGAAAAACAGCAGAAACAGACTATCGAACACCTGGAACAAGAGCACACAAATCGCTTG
XM_005270301.1      CTAGAAAAACAGCAGAAACAGACTATCGAACGCCTGGAACAAGAGCACACAAATCGCTTG
NM_014720.2         CTAGAAAAACAGCAGAAACAGACTATCGAACGCCTGGAACAAGAGCACACAAATCGCTTG
                    *******************************.****************************

HsCD00022368        CGAGATGAAGCCAAACGCATCAAAGGAGAACAAGAGAAAGAGTTGTCCAAATTTCAGAAT
XM_005270301.1      CGAGATGAAGCCAAACGCATCAAAGGAGAACAAGAGAAAGAGTTGTCCAAATTTCAGAAT
NM_014720.2         CGAGATGAAGCCAAACGCATCAAAGGAGAACAAGAGAAAGAGTTGTCCAAATTTCAGAAT
                    ************************************************************

HsCD00022368        ATGCTGAAGAACCGAAAGAAGGAG------------------------------------
XM_005270301.1      ATGCTGAAGAACCGAAAGAAGGAG------------------------------------
NM_014720.2         ATGCTGAAGAACCGAAAGAAGGAGGTTATAAATGAAGTGGAGAAAGCACCCAAAGAGCTG
                    ************************                                    

HsCD00022368        ---------------------------------------------------------GAA
XM_005270301.1      ---------------------------------------------------------GAA
NM_014720.2         AGAAAAGAGCTCATGAAACGCAGGAAAGAGGAGCTTGCACAAAGCCAGCATGCTCAGGAA
                                                                             ***

HsCD00022368        CAAGAGTTTGTTCAGAAACAACAGCAAGAATTAGATGGCTCTCTGAAAAAGATCATCCAG
XM_005270301.1      CAAGAGTTTGTTCAGAAACAACAGCAAGAATTAGATGGCTCTCTGAAAAAGATCATCCAG
NM_014720.2         CAAGAGTTTGTTCAGAAACAACAGCAAGAATTAGATGGCTCTCTGAAAAAGATCATCCAG
                    ************************************************************

HsCD00022368        CAGCAGAAGGCAGAGTTAGCTAATATTGAGAGAGAGTGCCTGAATAACAAGCAACAGCTC
XM_005270301.1      CAGCAGAAGGCAGAGTTAGCTAATATTGAGAGAGAGTGCCTGAATAACAAGCAACAGCTC
NM_014720.2         CAGCAGAAGGCAGAGTTAGCTAATATTGAGAGAGAGTGCCTGAATAACAAGCAACAGCTC
                    ************************************************************

HsCD00022368        ATGAGAGCTCGAGAAGCTGCAATTTGGGAGCTCGAAGAACGACACTTACAAGAAAAACAC
XM_005270301.1      ATGAGAGCTCGAGAAGCTGCAATTTGGGAGCTCGAAGAACGACACTTACAAGAAAAACAC
NM_014720.2         ATGAGAGCTCGAGAAGCTGCAATTTGGGAGCTCGAAGAACGACACTTACAAGAAAAACAC
                    ************************************************************

HsCD00022368        CAGCTGCTCAAACAGCAGCTTAAAGATCAGTATTTCATGCAAAGACATCAGCTACTTAAG
XM_005270301.1      CAGCTGCTCAAACAGCAGCTTAAAGATCAGTATTTCATGCAAAGACATCAGCTACTTAAG
NM_014720.2         CAGCTGCTCAAACAGCAGCTTAAAGATCAGTATTTCATGCAAAGACATCAGCTACTTAAG
                    ************************************************************

HsCD00022368        CGCCACGAGAAGGAAACAGAGCAAATGCAGCGTTACAATCAAAGACTTATTGAGGAATTG
XM_005270301.1      CGCCACGAGAAGGAAACAGAGCAAATGCAGCGTTACAATCAAAGACTTATTGAGGAATTG
NM_014720.2         CGCCACGAGAAGGAAACAGAGCAAATGCAGCGTTACAATCAAAGACTTATTGAGGAATTG
                    ************************************************************

HsCD00022368        AAAAACAGACAGACTCAAGAAAGAGCAAGACTGCCCAAGATTCAGCGCAGTGAAGCCAAG
XM_005270301.1      AAAAACAGACAGACTCAAGAAAGAGCAAGACTGCCCAAGATTCAGCGCAGTGAAGCCAAG
NM_014720.2         AAAAACAGACAGACTCAAGAAAGAGCAAGACTGCCCAAGATTCAGCGCAGTGAAGCCAAG
                    ************************************************************

HsCD00022368        ACTCGAATGGCCATGTTTAAGAAGAGTTTGAGAATTAACTCAACAGCCACACCAGATCAG
XM_005270301.1      ACTCGAATGGCCATGTTTAAGAAGAGTTTGAGAATTAACTCAACAGCCACACCAGATCAG
NM_014720.2         ACTCGAATGGCCATGTTTAAGAAGAGTTTGAGAATTAACTCAACAGCCACACCAGATCAG
                    ************************************************************

HsCD00022368        GACCGTGATAAAATTAAACAGTTTGCTGCACAAGAAGAAAAGAGGCAGAAAAATGAGAGA
XM_005270301.1      GACCGTGATAAAATTAAACAGTTTGCTGCACAAGAAGAAAAGAGGCAGAAAAATGAGAGA
NM_014720.2         GACCGTGATAAAATTAAACAGTTTGCTGCACAAGAAGAAAAGAGGCAGAAAAATGAGAGA
                    ************************************************************

HsCD00022368        ATGGCTCAGCATCAGAAACATGAGAATCAAATGCGAGATCTTCAGTTGCAGTGTGAAGCC
XM_005270301.1      ATGGCTCAGCATCAGAAACATGAGAATCAAATGCGAGATCTTCAGTTGCAGTGTGAAGCC
NM_014720.2         ATGGCTCAGCATCAGAAACATGAGAATCAAATGCGAGATCTTCAGTTGCAGTGTGAAGCC
                    ************************************************************

HsCD00022368        AATGTCCGCGAACTGCATCAGCTGCAGAATGAAAAATGCCACTTGTTGGTTGAGCATGAG
XM_005270301.1      AATGTCCGCGAACTGCATCAGCTGCAGAATGAAAAATGCCACTTGTTGGTTGAGCATGAG
NM_014720.2         AATGTCCGCGAACTGCATCAGCTGCAGAATGAAAAATGCCACTTGTTGGTTGAGCATGAG
                    ************************************************************

HsCD00022368        ACTCAGAAACTGAAGGAGTTAGATGAGGAACATAGCCAAGAATTAAAGGAGTGGAGAGAG
XM_005270301.1      ACTCAGAAACTGAAGGAGTTAGATGAGGAACATAGCCAAGAATTAAAGGAGTGGAGAGAG
NM_014720.2         ACTCAGAAACTGAAGGAGTTAGATGAGGAACATAGCCAAGAATTAAAGGAGTGGAGAGAG
                    ************************************************************

HsCD00022368        AAATTGAGACCTAGGAAAAAGACACTGGAAGAAGAGTTTGCCAGGAAACTACAGGAACAG
XM_005270301.1      AAATTGAGACCTAGGAAAAAGACACTGGAAGAAGAGTTTGCCAGGAAACTACAGGAACAG
NM_014720.2         AAATTGAGACCTAGGAAAAAGACACTGGAAGAAGAGTTTGCCAGGAAACTACAGGAACAG
                    ************************************************************

HsCD00022368        GAAGTATTCTTTAAAATGACTGGGGAGTCTGAATGCCTTAACCCATCAACACAGAGCCGG
XM_005270301.1      GAAGTATTCTTTAAAATGACTGGGGAGTCTGAATGCCTTAACCCATCAACACAGAGCCGG
NM_014720.2         GAAGTATTCTTTAAAATGACTGGGGAGTCTGAATGCCTTAACCCATCAACACAGAGCCGG
                    ************************************************************

HsCD00022368        ATTTCCAAATTTTATCCTATTCCCAGCTTGCATTCCACCGGATCATTG
XM_005270301.1      ATTTCCAAATTTTATCCTATTCCCAGCTTGCATTCCACCGGATCATAA
NM_014720.2         ATTTCCAAATTTTATCCTATTCCCAGCTTGCATTCCACCGGATCATAA
                    **********************************************:.

Pathways

NCI : Alpha-synuclein signaling
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : CXCR4-mediated signaling events
NCI : Class I PI3K signaling events
NCI : E-cadherin signaling in keratinocytes
NCI : EPHA forward signaling
NCI : Ephrin A reverse signaling
NCI : Ephrin B reverse signaling
NCI : ErbB4 signaling events
NCI : Fc-epsilon receptor I signaling in mast cells
NCI : Glypican 1 network
NCI : IL2-mediated signaling events
NCI : Nephrin/Neph1 signaling in the kidney podocyte
NCI : Netrin-mediated signaling events
NCI : PDGFR-beta signaling pathway
NCI : Posttranslational regulation of adherens junction stability and dissassembly
NCI : Reelin signaling pathway
NCI : Regulation of p38-alpha and p38-beta
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by VEGFR1 and VEGFR2
NCI : Signaling events mediated by focal adhesion kinase
NCI : Syndecan-3-mediated signaling events
NCI : TCR signaling in naïve CD4+ T cells
NCI : TCR signaling in naïve CD8+ T cells
NCI : Thromboxane A2 receptor signaling
NCI : amb2 Integrin signaling
Panther : Axon guidance mediated by semaphorins
Panther : Cadherin signaling pathway
Panther : Integrin signalling pathway
Panther : Parkinson disease
Reactome : Adaptive Immune System
Reactome : Antigen activates B Cell Receptor (BCR) leading to generation of second messengers
Reactome : Axon guidance
Reactome : CD28 co-stimulation
Reactome : CD28 dependent PI3K/Akt signaling
Reactome : CD28 dependent Vav1 pathway
Reactome : CRMPs in Sema3A signaling
Reactome : CTLA4 inhibitory signaling
Reactome : Cell surface interactions at the vascular wall
Reactome : Cell-Cell communication
Reactome : Constitutive PI3K/AKT Signaling in Cancer
Reactome : Costimulation by the CD28 family
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : DCC mediated attractive signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : FCGR activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : GAB1 signalosome
Reactome : GPVI-mediated activation cascade
Reactome : HIV Infection
Reactome : Hemostasis
Reactome : Host Interactions of HIV factors
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nef and signal transduction
Reactome : Nephrin interactions
Reactome : Netrin mediated repulsion signals
Reactome : Netrin-1 signaling
Reactome : PECAM1 interactions
Reactome : PI-3K cascade
Reactome : PI3K events in ERBB2 signaling
Reactome : PI3K events in ERBB4 signaling
Reactome : PI3K/AKT Signaling in Cancer
Reactome : PI3K/AKT activation
Reactome : PIP3 activates AKT signaling
Reactome : Platelet Adhesion to exposed collagen
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of KIT signaling
Reactome : Regulation of signaling by CBL
Reactome : Role of LAT2/NTAL/LAB on calcium mobilization
Reactome : SEMA3A-Plexin repulsion signaling by inhibiting Integrin adhesion
Reactome : Sema3A PAK dependent Axon repulsion
Reactome : Semaphorin interactions
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : The role of Nef in HIV-1 replication and disease pathogenesis
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : Focal Adhesion
WikiPathway : IL-2 Signaling pathway
WikiPathway : IL-3 Signaling Pathway
WikiPathway : IL-7 signaling pathway
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Leptin signaling pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : TCR Signaling Pathway

Clone

Cloning Information : 163302
HIP Master Clone ID : 136502
Original Clone ID : FLH163302.01F

Organism


TAX_ID : 9606
Species Specific ID: 2534

Genome

Chromosome : 10
Map Location : 10q24.33
Ensembl : ENSG00000065613

Reagents

Labome : SLK-antibody