DNASU Plasmid Repository • 480.965.5697 | Email

ATM (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ATM
Gene Name:  ataxia telangiectasia mutated
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026721.01X
Keyword: potential short variant
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: Short variant or partial clone comparing to NM_000051
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00022525

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 417nts         Open reading frame : 1 to 417
Reference Sequence Alignment

ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGTCAGAGCACTGACCTCTGTGACTTT
TCAGGGGATTTGGATCCTGCTCCTAATCCACCTCATTTTCCATCGCATGTGGTTAAAGCA
ACATTTGCCTATATCAGCAATTGTCATAAAACCAAGTTAAAAAGCATTTTAGAAATTCTT
TCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTTGCCATATGTGAGCAAGCAGCTGAA
ACAAATAATGTTTATAAGAAGCACAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTA
TTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCTTGGGCCTTTGTTCTTCGAGACGTT
ATTTATACTTTGATTCACTATATCAACCAAAGGAAATTAACCATTTTCTCTCAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 490
Start on reference sequence 74
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ATM
Symbol Nomenclature : ATM
SYNONYM : AT1; ATA; ATC; ATD; ATDC; ATE; TEL1; TELO1
Designation : A-T mutated|AT mutated|TEL1, telomere maintenance 1, homolog|serine-protein kinase ATM
Full Nomenclature : ataxia telangiectasia mutated
GENEID : 472
GI : 61361134
GenBank Accession : AY890055
HGNC : 795
MIM : 607585
Vega : OTTHUMG00000166480
Target GenBank: BC007023

 

Reference Sequence Alignment

  

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATGAGTCTAGTACTTAATGATCTGCTTATCTGCTGCCGTCAACTAGAACATGATAGAGCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACAGAACGAAAGAAAGAAGTTGAGAAATTTAAGCGCCTGATTCGAGATCCTGAAACAATT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAACATCTAGATCGGCATTCAGATTCCAAACAAGGAAAATATTTGAATTGGGATGCTGTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTTAGATTTTTACAGAAATATATTCAGAAAGAAACAGAATGTCTGAGAATAGCAAAACCA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AATGTATCAGCCTCAACACAAGCCTCCAGGCAGAAAAAGATGCAGGAAATCAGTAGTTTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTCAAATACTTCATCAAATGTGCAAACAGAAGAGCACCTAGGCTAAAATGTCAAGAACTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTAAATTATATCATGGATACAGTGAAAGATTCATCTAATGGTGCTATTTACGGAGCTGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGTAGCAACATACTACTCAAAGACATTCTTTCTGTGAGAAAATACTGGTGTGAAATATCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGCAACAGTGGTTAGAATTGTTCTCTGTGTACTTCAGGCTCTATCTGAAACCTTCACAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GATGTTCATAGAGTTTTAGTGGCTAGAATAATTCATGCTGTTACCAAAGGATGCTGTTCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGACTGACGGATTAAATTCCAAATTTTTGGACTTTTTTTCCAAGGCTATTCAGTGTGCG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGACAAGAAAAGAGCTCTTCAGGTCTAAATCATATCTTAGCAGCTCTTACTATCTTCCTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAGACTTTGGCTGTCAACTTTCGAATTCGAGTGTGTGAATTAGGAGATGAAATTCTTCCC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACTTTGCTTTATATTTGGACTCAACATAGGCTTAATGATTCTTTAAAAGAAGTCATTATT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAATTATTTCAACTGCAAATTTATATCCATCATCCGAAAGGAGCCAAAACCCAAGAAAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GGTGCTTATGAATCAACAAAATGGAGAAGTATTTTATACAACTTATATGATCTGCTAGTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AATGAGATAAGTCATATAGGAAGTAGAGGAAAGTATTCTTCAGGATTTCGTAATATTGCC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTCAAAGAAAATTTGATTGAATTGATGGCAGATATCTGTCACCAGGTTTTTAATGAAGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACCAGATCCTTGGAGATTTCTCAATCTTACACTACTACACAAAGAGAATCTAGTGATTAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGTGTCCCTTGCAAAAGGAAGAAAATAGAACTAGGCTGGGAAGTAATAAAAGATCACCTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGAAGTCACAGAATGATTTTGATCTTGTGCCTTGGCTACAGATTGCAACCCAATTAATA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCAAAGTATCCTGCAAGTTTACCTAACTGTGAGCTGTCTCCATTACTGATGATACTATCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGCTTCTACCCCAACAGCGACATGGGGAACGTACACCATATGTGTTACGATGCCTTACG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAAGTTGCATTGTGTCAAGACAAGAGGTCAAACCTAGAAAGCTCACAAAAGTCAGATTTA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTAAAACTCTGGAATAAAATTTGGTGTATTACCTTTCGTGGTATAAGTTCTGAGCAAATA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAAGCTGAAAACTTTGGCTTACTTGGAGCCATAATTCAGGGTAGTTTAGTTGAGGTTGAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGAGAATTCTGGAAGTTATTTACTGGGTCAGCCTGCAGACCTTCATGTCCTGCAGTATGC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGTTTGACTTTGGCACTGACCACCAGTATAGTTCCAGGAACGGTAAAAATGGGAATAGAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAAAATATGTGTGAAGTAAATAGAAGCTTTTCTTTAAAGGAATCAATAATGAAATGGCTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTATTCTATCAGTTAGAGGGTGACTTAGAAAATAGCACAGAAGTGCCTCCAATTCTTCAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGTAATTTTCCTCATCTTGTACTGGAGAAAATTCTTGTGAGTCTCACTATGAAAAACTGT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAAGCTGCAATGAATTTTTTCCAAAGCGTGCCAGAATGTGAACACCACCAAAAAGATAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAAGAACTTTCATTCTCAGAAGTAGAAGAACTATTTCTTCAGACAACTTTTGACAAGATG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GACTTTTTAACCATTGTGAGAGAATGTGGTATAGAAAAGCACCAGTCCAGTATTGGCTTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCTGTCCACCAGAATCTCAAGGAATCACTGGATCGCTGTCTTCTGGGATTATCAGAACAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTTCTGAATAATTACTCATCTGAGATTACAAATTCAGAAACTCTTGTCCGGTGTTCACGT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTTTTGGTGGGTGTCCTTGGCTGCTACTGTTACATGGGTGTAATAGCTGAAGAGGAAGCA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TATAAGTCAGAATTATTCCAGAAAGCCAAGTCTCTAATGCAATGTGCAGGAGAAAGTATC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACTCTGTTTAAAAATAAGACAAATGAGGAATTCAGAATTGGTTCCTTGAGAAATATGATG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGCTATGTACACGTTGCTTGAGCAACTGTACCAAGAAGAGTCCAAATAAGATTGCATCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GGCTTTTTCCTGCGATTGTTAACATCAAAGCTAATGAATGACATTGCAGATATTTGTAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGTTTAGCATCCTTCATCAAAAAGCCATTTGACCGTGGAGAAGTAGAATCAATGGAAGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GATACTAATGGAAATCTAATGGAGGTGGAGGATCAGTCATCCATGAATCTATTTAACGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TACCCTGATAGTAGTGTTAGTGATGCAAACGAACCTGGAGAGAGCCAAAGTACCATAGGT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GCCATTAATCCTTTAGCTGAAGAATATCTGTCAAAGCAAGATCTACTTTTCTTAGACATG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTCAAGTTCTTGTGTTTGTGTGTAACTACTGCTCAGACCAATACTGTGTCCTTTAGGGCA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GCTGATATTCGGAGGAAATTGTTAATGTTAATTGATTCTAGCACGCTAGAACCTACCAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCCCTCCACCTGCATATGTATCTAATGCTTTTAAAGGAGCTTCCTGGAGAAGAGTACCCC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTGCCAATGGAAGATGTTCTTGAACTTCTGAAACCACTATCCAATGTGTGTTCTTTGTAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CGTCGTGACCAAGATGTTTGTAAAACTATTTTAAACCATGTCCTTCATGTAGTGAAAAAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTAGGTCAAAGCAATATGGACTCTGAGAACACAAGGGATGCTCAAGGACAGTTTCTTACA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTAATTGGAGCATTTTGGCATCTAACAAAGGAGAGGAAATATATATTCTCTGTAAGAATG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GCCCTAGTAAATTGCCTTAAAACTTTGCTTGAGGCTGATCCTTATTCAAAATGGGCCATT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTTAATGTAATGGGAAAAGACTTTCCTGTAAATGAAGTATTTACACAATTTCTTGCTGAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AATCATCACCAAGTTCGCATGTTGGCTGCAGAGTCAATCAATAGATTGTTCCAGGACACG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAGGGAGATTCTTCCAGGTTACTGAAAGCACTTCCTTTGAAGCTTCAGCAAACAGCTTTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAAAATGCATACTTGAAAGCTCAGGAAGGAATGAGAGAAATGTCCCATAGTGCTGAGAAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CCTGAAACTTTGGATGAAATTTATAATAGAAAATCTGTTTTACTGACGTTGATAGCTGTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTTTTATCCTGTAGCCCTATCTGCGAAAAACAGGCTTTGTTTGCCCTGTGTAAATCTGTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAAGAGAATGGATTAGAACCTCACCTTGTGAAAAAGGTTTTAGAGAAAGTTTCTGAAACT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTTGGATATAGACGTTTAGAAGACTTTATGGCATCTCATTTAGATTATCTGGTTTTGGAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGGCTAAATCTTCAAGATACTGAATACAACTTATCTTCTTTTCCTTTTATTTTATTAAAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TACACAAATATTGAGGATTTCTATAGATCTTGTTATAAGGTTTTGATTCCACATCTGGTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATTAGAAGTCATTTTGATGAGGTGAAGTCCATTGCTAATCAGATTCAAGAGGACTGGAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGTCTTCTAACAGACTGCTTTCCAAAGATTCTTGTAAATATTCTTCCTTATTTTGCCTAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAGGGTACCAGAGACAGTGGGATGGCACAGCAAAGAGAGACTGCTACCAAGGTCTATGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATGCTTAAAAGTGAAAACTTATTGGGAAAACAGATTGATCACTTATTCATTAGTAATTTA
                                                                              

HsCD00022525      ------------------------ATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
NM_000051.3       CCAGAGATTGTGGTGGAGTTATTGATGACGTTACATGAGCCAGCAAATTCTAGTGCCAGT
                                          ************************************

HsCD00022525      CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
NM_000051.3       CAGAGCACTGACCTCTGTGACTTTTCAGGGGATTTGGATCCTGCTCCTAATCCACCTCAT
                  ************************************************************

HsCD00022525      TTTCCATCGCATGTGGTTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
NM_000051.3       TTTCCATCGCATGTGATTAAAGCAACATTTGCCTATATCAGCAATTGTCATAAAACCAAG
                  ***************.********************************************

HsCD00022525      TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
NM_000051.3       TTAAAAAGCATTTTAGAAATTCTTTCCAAAAGCCCTGATTCCTATCAGAAAATTCTTCTT
                  ************************************************************

HsCD00022525      GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
NM_000051.3       GCCATATGTGAGCAAGCAGCTGAAACAAATAATGTTTATAAGAAGCACAGAATTCTTAAA
                  ************************************************************

HsCD00022525      ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
NM_000051.3       ATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAAGTGGCTTAGGAGGAGCT
                  ************************************************************

HsCD00022525      TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAG----
NM_000051.3       TGGGCCTTTGTTCTTCGAGACGTTATTTATACTTTGATTCACTATATCAACCAAAGGCCT
                  ********************************************************    

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCTTGTATCATGGATGTGTCATTACGTAGCTTCTCCCTTTGTTGTGACTTATTAAGTCAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTTTGCCAGACAGCCGTGACTTACTGTAAGGATGCTCTAGAAAACCATCTTCATGTTATT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTTGGTACACTTATACCCCTTGTGTATGAGCAGGTGGAGGTTCAGAAACAGGTATTGGAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTGTTGAAATACTTAGTGATAGATAACAAGGATAATGAAAACCTCTATATCACGATTAAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTTTTAGATCCTTTTCCTGACCATGTTGTTTTTAAGGATTTGCGTATTACTCAGCAAAAA
                                                                              

HsCD00022525      ------------------------------------GAAATTAACCATTTTCTCTCAGTA
NM_000051.3       ATCAAATACAGTAGAGGACCCTTTTCACTCTTGGAGGAAATTAACCATTTTCTCTCAGTA
                                                      ************************

HsCD00022525      G-----------------------------------------------------------
NM_000051.3       AGTGTTTATGATGCACTTCCATTGACAAGACTTGAAGGACTAAAGGATCTTCGAAGACAA
                  .                                                           

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTGGAACTACATAAAGATCAGATGGTGGACATTATGAGAGCTTCTCAGGATAATCCGCAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GATGGGATTATGGTGAAACTAGTTGTCAATTTGTTGCAGTTATCCAAGATGGCAATAAAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CACACTGGTGAAAAAGAAGTTCTAGAGGCTGTTGGAAGCTGCTTGGGAGAAGTGGGTCCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATAGATTTCTCTACCATAGCTATACAACATAGTAAAGATGCATCTTATACCAAGGCCCTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAGTTATTTGAAGATAAAGAACTTCAGTGGACCTTCATAATGCTGACCTACCTGAATAAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACACTGGTAGAAGATTGTGTCAAAGTTCGATCAGCAGCTGTTACCTGTTTGAAAAACATT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTAGCCACAAAGACTGGACATAGTTTCTGGGAGATTTATAAGATGACAACAGATCCAATG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTGGCCTATCTACAGCCTTTTAGAACATCAAGAAAAAAGTTTTTAGAAGTACCCAGATTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GACAAAGAAAACCCTTTTGAAGGCCTGGATGATATAAATCTGTGGATTCCTCTAAGTGAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AATCATGACATTTGGATAAAGACACTGACTTGTGCTTTTTTGGACAGTGGAGGCACAAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGTGAAATTCTTCAATTATTAAAGCCAATGTGTGAAGTGAAAACTGACTTTTGTCAGACT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTACTTCCATACTTGATTCATGATATTTTACTCCAAGATACAAATGAATCATGGAGAAAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTGCTTTCTACACATGTTCAGGGATTTTTCACCAGCTGTCTTCGACACTTCTCGCAAACG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGCCGATCCACAACCCCTGCAAACTTGGATTCAGAGTCAGAGCACTTTTTCCGATGCTGT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTGGATAAAAAATCACAAAGAACAATGCTTGCTGTTGTGGACTACATGAGAAGACAAAAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGACCTTCTTCAGGAACAATTTTTAATGATGCTTTCTGGCTGGATTTAAATTATCTAGAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTTGCCAAGGTAGCTCAGTCTTGTGCTGCTCACTTTACAGCTTTACTCTATGCAGAAATC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TATGCAGATAAGAAAAGTATGGATGATCAAGAGAAAAGAAGTCTTGCATTTGAAGAAGGA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGCCAGAGTACAACTATTTCTAGCTTGAGTGAAAAAAGTAAAGAAGAAACTGGAATAAGT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTACAGGATCTTCTCTTAGAAATCTACAGAAGTATAGGGGAGCCAGATAGTTTGTATGGC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGTGGTGGAGGGAAGATGTTACAACCCATTACTAGACTACGAACATATGAACACGAAGCA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATGTGGGGCAAAGCCCTAGTAACATATGACCTCGAAACAGCAATCCCCTCATCAACACGC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGGCAGGAATCATTCAGGCCTTGCAGAATTTGGGACTCTGCCATATTCTTTCCGTCTAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TTAAAAGGATTGGATTATGAAAATAAAGACTGGTGTCCTGAACTAGAAGAACTTCATTAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAAGCAGCATGGAGGAATATGCAGTGGGACCATTGCACTTCCGTCAGCAAAGAAGTAGAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GGAACCAGTTACCATGAATCATTGTACAATGCTCTACAATCTCTAAGAGACAGAGAATTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCTACATTTTATGAAAGTCTCAAATATGCCAGAGTAAAAGAAGTGGAAGAGATGTGTAAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CGCAGCCTTGAGTCTGTGTATTCGCTCTATCCCACACTTAGCAGGTTGCAGGCCATTGGA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAGCTGGAAAGCATTGGGGAGCTTTTCTCAAGATCAGTCACACATAGACAACTCTCTGAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTATATATTAAGTGGCAGAAACACTCCCAGCTTCTCAAGGACAGTGATTTTAGTTTTCAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAGCCTATCATGGCTCTACGCACAGTCATTTTGGAGATCCTGATGGAAAAGGAAATGGAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AACTCACAAAGAGAATGTATTAAGGACATTCTCACCAAACACCTTGTAGAACTCTCTATA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTGGCCAGAACTTTCAAGAACACTCAGCTCCCTGAAAGGGCAATATTTCAAATTAAACAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TACAATTCAGTTAGCTGTGGAGTCTCTGAGTGGCAGCTGGAAGAAGCACAAGTATTCTGG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GCAAAAAAGGAGCAGAGTCTTGCCCTGAGTATTCTCAAGCAAATGATCAAGAAGTTGGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GCCAGCTGTGCAGCGAACAATCCCAGCCTAAAACTTACATACACAGAATGTCTGAGGGTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGTGGCAACTGGTTAGCAGAAACGTGCTTAGAAAATCCTGCGGTCATCATGCAGACCTAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTAGAAAAGGCAGTAGAAGTTGCTGGAAATTATGATGGAGAAAGTAGTGATGAGCTAAGA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AATGGAAAAATGAAGGCATTTCTCTCATTAGCCCGGTTTTCAGATACTCAATACCAAAGA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATTGAAAACTACATGAAATCATCGGAATTTGAAAACAAGCAAGCTCTCCTGAAAAGAGCC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AAAGAGGAAGTAGGTCTCCTTAGGGAACATAAAATTCAGACAAACAGATACACAGTAAAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTTCAGCGAGAGCTGGAGTTGGATGAATTAGCCCTGCGTGCACTGAAAGAGGATCGTAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CGCTTCTTATGTAAAGCAGTTGAAAATTATATCAACTGCTTATTAAGTGGAGAAGAACAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GATATGTGGGTATTCCGACTTTGTTCCCTCTGGCTTGAAAATTCTGGAGTTTCTGAAGTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AATGGCATGATGAAGAGAGACGGAATGAAGATTCCAACATATAAATTTTTGCCTCTTATG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TACCAATTGGCTGCTAGAATGGGGACCAAGATGATGGGAGGCCTAGGATTTCATGAAGTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTCAATAATCTAATCTCTAGAATTTCAATGGATCACCCCCATCACACTTTGTTTATTATA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CTGGCCTTAGCAAATGCAAACAGAGATGAATTTCTGACTAAACCAGAGGTAGCCAGAAGA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGCAGAATAACTAAAAATGTGCCTAAACAAAGCTCTCAGCTTGATGAGGATCGAACAGAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GCTGCAAATAGAATAATATGTACTATCAGAAGTAGGAGACCTCAGATGGTCAGAAGTGTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAGGCACTTTGTGATGCTTATATTATATTAGCAAACTTAGATGCCACTCAGTGGAAGACT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGAGAAAAGGCATAAATATTCCAGCAGACCAGCCAATTACTAAACTTAAGAATTTAGAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GATGTTGTTGTCCCTACTATGGAAATTAAGGTGGACCACACAGGAGAATATGGAAATCTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTGACTATACAGTCATTTAAAGCAGAATTTCGCTTAGCAGGAGGTGTAAATTTACCAAAA
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATAATAGATTGTGTAGGTTCCGATGGCAAGGAGAGGAGACAGCTTGTTAAGGGCCGTGAT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GACCTGAGACAAGATGCTGTCATGCAACAGGTCTTCCAGATGTGTAATACATTACTGCAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGAAACACGGAAACTAGGAAGAGGAAATTAACTATCTGTACTTATAAGGTGGTTCCCCTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCTCAGCGAAGTGGTGTTCTTGAATGGTGCACAGGAACTGTCCCCATTGGTGAATTTCTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GTTAACAATGAAGATGGTGCTCATAAAAGATACAGGCCAAATGATTTCAGTGCCTTTCAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TGCCAAAAGAAAATGATGGAGGTGCAAAAAAAGTCTTTTGAAGAGAAATATGAAGTCTTC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATGGATGTTTGCCAAAATTTTCAACCAGTTTTCCGTTACTTCTGCATGGAAAAATTCTTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GATCCAGCTATTTGGTTTGAGAAGCGATTGGCTTATACGCGCAGTGTAGCTACTTCTTCT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ATTGTTGGTTACATACTTGGACTTGGTGATAGACATGTACAGAATATCTTGATAAATGAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CAGTCAGCAGAACTTGTACATATAGATCTAGGTGTTGCTTTTGAACAGGGCAAAATCCTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CCTACTCCTGAGACAGTTCCTTTTAGACTCACCAGAGATATTGTGGATGGCATGGGCATT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACGGGTGTTGAAGGTGTCTTCAGAAGATGCTGTGAGAAAACCATGGAAGTGATGAGAAAC
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       TCTCAGGAAACTCTGTTAACCATTGTAGAGGTCCTTCTATATGATCCACTCTTTGACTGG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       ACCATGAATCCTTTGAAAGCTTTGTATTTACAGCAGAGGCCGGAAGATGAAACTGAGCTT
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       CACCCTACTCTGAATGCAGATGACCAAGAATGCAAACGAAATCTCAGTGATATTGACCAG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       AGTTTCAACAAAGTAGCTGAACGTGTCTTAATGAGACTACAAGAGAAACTGAAAGGAGTG
                                                                              

HsCD00022525      ------------------------------------------------------------
NM_000051.3       GAAGAAGGCACTGTGCTCAGTGTTGGTGGACAAGTGAATTTGCTCATACAGCAGGCCATA
                                                                              

HsCD00022525      ---------------------------------------------------
NM_000051.3       GACCCCAAAAATCTCAGCCGACTTTTCCCAGGATGGAAAGCTTGGGTGTGA
                                                                     

Pathways

NCI : ATM pathway
NCI : BARD1 signaling events
NCI : Canonical NF-kappaB pathway
NCI : E2F transcription factor network
NCI : Fanconi anemia pathway
NCI : Regulation of Telomerase
NCI : Validated transcriptional targets of deltaNp63 isoforms
NCI : p38 MAPK signaling pathway
NCI : p53 pathway
Panther : p53 pathway
Panther : p53 pathway feedback loops 2
Reactome : ATM mediated phosphorylation of repair proteins
Reactome : ATM mediated response to DNA double-strand break
Reactome : Autodegradation of the E3 ubiquitin ligase COP1
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cellular Senescence
Reactome : Cellular response to heat stress
Reactome : Cellular responses to stress
Reactome : DNA Damage/Telomere Stress Induced Senescence
Reactome : DNA Repair
Reactome : Double-Strand Break Repair
Reactome : Fanconi Anemia pathway
Reactome : G1/S DNA Damage Checkpoints
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : Homologous Recombination Repair
Reactome : Homologous recombination repair of replication-independent double-strand breaks
Reactome : Meiosis
Reactome : Meiotic recombination
Reactome : Recruitment of repair and signaling proteins to double-strand breaks
Reactome : Regulation of HSF1-mediated heat shock response
Reactome : Regulation of the Fanconi anemia pathway
Reactome : Stabilization of p53
Reactome : Ubiquitin Mediated Degradation of Phosphorylated Cdc25A
Reactome : p53-Dependent G1 DNA Damage Response
Reactome : p53-Dependent G1/S DNA damage checkpoint
Reactome : p53-Independent DNA Damage Response
Reactome : p53-Independent G1/S DNA damage checkpoint
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : G1 to S cell cycle control
WikiPathway : Homologous recombination
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Integrated Cancer pathway
WikiPathway : Ovarian Infertility Genes
WikiPathway : TP53 network
WikiPathway : miRNA regulation of DNA Damage Response
WikiPathway : miRNAs involved in DDR

Protein

UniProt : Q13315
HPRD : 06347

Clone

Cloning Information : 26721
HIP Master Clone ID : 57097
Original Clone ID : FLH026721.01X

Organism


TAX_ID : 9606
Species Specific ID: 472

Genome

Chromosome : 11
Map Location : 11q22-q23
Ensembl : ENSG00000149311

Reagents

Labome : ATM-antibody