DNASU Plasmid Repository • 480.965.5697 | Email

FGF13 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  FGF13
Gene Name:  fibroblast growth factor 13
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH124024.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000227

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 738nts         Open reading frame : 1 to 738
Reference Sequence Alignment

ATGGCGGCGGCTATCGCCAGCTCGCTCATCCGTCAGAAGAGGCAAGCCCGCGAGCGCGAG
AAATCCAACGCCTGCAAGTGTGTCAGCAGCCCCAGCAAAGGCAAGACCAGCTGCGACAAA
AACAAGTTAAATGTCTTTTCCCGGGTCAAACTCTTCGGCTCCAAGAAGAGGCGCAGAAGA
AGACCAGAGCCTCAGCTTAAGGGTATAGTTACCAAGCTATACAGCCGACAAGGCTACCAC
TTGCAGCTGCAGGCGGATGGAACCATTGATGGCACCAAAGATGAGGACAGCACTTACACT
CTGTTTAACCTCATCCCTGTGGGTCTGCGAGTGGTGGCTATCCAAGGAGTTCAAACCAAG
CTGTACTTGGCAATGAACAGTGAGGGATACTTGTACACCTCGGAACTTTTCACACCTGAG
TGCAAATTCAAAGAATCAGTGTTTGAAAATTATTATGTGACATATTCATCAATGATATAC
CGTCAGCAGCAGTCAGGCCGAGGGTGGTATCTGGGTCTGAACAAAGAAGGAGAGATCATG
AAAGGCAACCATGTGAAGAAGAACAAGCCTGCAGCTCATTTTCTGCCTAAACCACTGAAA
GTGGCCATGTACAAGGAGCCATCACTGCACGATCTCACGGAGTTCTCCCGATCTGGAAGC
GGGACCCCAACCAAGAGCAGAAGTGTCTCTGGCGTGCTGAACGGAGGCAAATCCATGAGC
CACAATGAATCAACGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 968
Start on reference sequence 231
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : FGF13
Symbol Nomenclature : FGF13
SYNONYM : FGF-13; FGF2; FHF-2; FHF2
Designation : fibroblast growth factor homologous factor 2
Full Nomenclature : fibroblast growth factor 13
GENEID : 2258
Locus Tag : RP6-27P15.3
GI : 60825648
GenBank Accession : AY893691
HGNC : 3670
MIM : 300070
Vega : OTTHUMG00000022532
Target GenBank: NM_004114

 

Reference Sequence Alignment

  

HsCD00000227        -ATGGCGGCGGCTATCGCCAGCTCGCTCATCCGTCAGAAGAGGCAAGCCCGCGAGCGCGA
NM_001139501.1      ------------------------------------------------------------
XM_005262399.1      ATGAGTGGAAAGGTGACCAAGCCCAAAGAGGAGAAAGATGCTTCTAAGGTTCTGGATGAC
NM_004114.3         -ATGGCGGCGGCTATCGCCAGCTCGCTCATCCGTCAGAAGAGGCAAGCCCGCGAGCGCGA
NM_001139502.1      ------------------------------------------------------------
NM_001139500.1      ATGAGTGGAAAGGTGACCAAGCCCAAAGAGGAGAAAGATGCTTCTAAGGTTCTGGATGAC
                                                                                

HsCD00000227        GAAATCCAACGCCTGCAAGTGTGTCAGCAGCCCCAGCAAAGGCAAGACCAGCTGCGACAA
NM_001139501.1      ---------------------------ATGTTACGACAAGATTCCATCCAATCTGCGGAA
XM_005262399.1      GCCCCCCCTGGCACACAGGAATACATTATGTTACGACAAGATTCCATCCAATCTGCGGAA
NM_004114.3         GAAATCCAACGCCTGCAAGTGTGTCAGCAGCCCCAGCAAAGGCAAGACCAGCTGCGACAA
NM_001139502.1      ---------------------------ATGTTACGACAAGATTCCATCCAATCTGCGGAA
NM_001139500.1      GCCCCCCCTGGCACACAGGAATACATTATGTTACGACAAGATTCCATCCAATCTGCGGAA
                                               .:*  .*..***..  ...:***.     . **

HsCD00000227        AAACAAGTTAAATG-----------------------------TCTTTTCCCGGGTCAAA
NM_001139501.1      TTAAAGAAAAAAGAGTCCCCCTTTCGTGCTAAGTGTCACGAAATCTTCTGCTGCCCGCTG
XM_005262399.1      TTAAAGAAAAAAGAGTCCCCCTTTCGTGCTAAGTGTCACGAAATCTTCTGCTGCCCGCTG
NM_004114.3         AAACAAGTTAAATG-----------------------------TCTTTTCCCGGGTCAAA
NM_001139502.1      TTAAAGAAAAAAGAGTCCCCCTTTCGTGCTAAGTGTCACGAAATCTTCTGCTGCCCGCTG
NM_001139500.1      TTAAAGAAAAAAGAGTCCCCCTTTCGTGCTAAGTGTCACGAAATCTTCTGCTGCCCGCTG
                    ::*.*..::*** .                             **** * * *    .:.

HsCD00000227        CTCTTCGGCTCCAAGAAGAGGCGCAGAAGAAGACCAGAGCCTCAGCTTAAGGGTATAGTT
NM_001139501.1      AAGCAAGTACACCACAAAGAGAACACAGAGCCGGAAGAGCCTCAGCTTAAGGGTATAGTT
XM_005262399.1      AAGCAAGTACACCACAAAGAGAACACAGAGCCGGAAGAGCCTCAGCTTAAGGGTATAGTT
NM_004114.3         CTCTTCGGCTCCAAGAAGAGGCGCAGAAGAAGACCAGAGCCTCAGCTTAAGGGTATAGTT
NM_001139502.1      AAGCAAGTACACCACAAAGAGAACACAGAGCCGGAAGAGCCTCAGCTTAAGGGTATAGTT
NM_001139500.1      AAGCAAGTACACCACAAAGAGAACACAGAGCCGGAAGAGCCTCAGCTTAAGGGTATAGTT
                    .:  :.* . .*.* **...*..** *.... . .*************************

HsCD00000227        ACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGAT
NM_001139501.1      ACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGAT
XM_005262399.1      ACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGAT
NM_004114.3         ACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGAT
NM_001139502.1      ACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGAT
NM_001139500.1      ACCAAGCTATACAGCCGACAAGGCTACCACTTGCAGCTGCAGGCGGATGGAACCATTGAT
                    ************************************************************

HsCD00000227        GGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCTGTGGGTCTGCGA
NM_001139501.1      GGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCTGTGGGTCTGCGA
XM_005262399.1      GGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCTGTGGGTCTGCGA
NM_004114.3         GGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCTGTGGGTCTGCGA
NM_001139502.1      GGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCTGTGGGTCTGCGA
NM_001139500.1      GGCACCAAAGATGAGGACAGCACTTACACTCTGTTTAACCTCATCCCTGTGGGTCTGCGA
                    ************************************************************

HsCD00000227        GTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAACAGTGAGGGATAC
NM_001139501.1      GTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAACAGTGAGGGATAC
XM_005262399.1      GTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAACAGTGAGGGATAC
NM_004114.3         GTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAACAGTGAGGGATAC
NM_001139502.1      GTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAACAGTGAGGGATAC
NM_001139500.1      GTGGTGGCTATCCAAGGAGTTCAAACCAAGCTGTACTTGGCAATGAACAGTGAGGGATAC
                    ************************************************************

HsCD00000227        TTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAGTGTTTGAAAAT
NM_001139501.1      TTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAGTGTTTGAAAAT
XM_005262399.1      TTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAGTGTTTGAAAAT
NM_004114.3         TTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAGTGTTTGAAAAT
NM_001139502.1      TTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAGTGTTTGAAAAT
NM_001139500.1      TTGTACACCTCGGAACTTTTCACACCTGAGTGCAAATTCAAAGAATCAGTGTTTGAAAAT
                    ************************************************************

HsCD00000227        TATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTAT
NM_001139501.1      TATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTAT
XM_005262399.1      TATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTAT
NM_004114.3         TATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTAT
NM_001139502.1      TATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTAT
NM_001139500.1      TATTATGTGACATATTCATCAATGATATACCGTCAGCAGCAGTCAGGCCGAGGGTGGTAT
                    ************************************************************

HsCD00000227        CTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCT
NM_001139501.1      CTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCT
XM_005262399.1      CTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCT
NM_004114.3         CTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCT
NM_001139502.1      CTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCT
NM_001139500.1      CTGGGTCTGAACAAAGAAGGAGAGATCATGAAAGGCAACCATGTGAAGAAGAACAAGCCT
                    ************************************************************

HsCD00000227        GCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCAC
NM_001139501.1      GCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCAC
XM_005262399.1      GCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCAC
NM_004114.3         GCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCAC
NM_001139502.1      GCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCAC
NM_001139500.1      GCAGCTCATTTTCTGCCTAAACCACTGAAAGTGGCCATGTACAAGGAGCCATCACTGCAC
                    ************************************************************

HsCD00000227        GATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCT
NM_001139501.1      GATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCT
XM_005262399.1      GATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCT
NM_004114.3         GATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCT
NM_001139502.1      GATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCT
NM_001139500.1      GATCTCACGGAGTTCTCCCGATCTGGAAGCGGGACCCCAACCAAGAGCAGAAGTGTCTCT
                    ************************************************************

HsCD00000227        GGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACGTTG
NM_001139501.1      GGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACGTAG
XM_005262399.1      GGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACGTAG
NM_004114.3         GGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACGTAG
NM_001139502.1      GGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACGTAG
NM_001139500.1      GGCGTGCTGAACGGAGGCAAATCCATGAGCCACAATGAATCAACGTAG
                    **********************************************:*

Pathways

Panther : FGF signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton

Protein

SMART domain : FGF : Acidic and basic fibroblast growth factor family.
UniProt : A8K1P5
UniProt : B7Z4M7
UniProt : B7Z8N0
UniProt : D3DWH4
UniProt : Q92913
HPRD : 02090

Clone

Cloning Information : 124024
HIP Master Clone ID : 100026
Original Clone ID : FLH124024.01L

Organism


TAX_ID : 9606
Species Specific ID: 2258

Genome

Chromosome : X
Map Location : Xq26.3
Ensembl : ENSG00000129682

Reagents

Labome : FGF13-antibody