DNASU Plasmid Repository • 480.965.5697 | Email

DNCI2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  DYNC1I2
Gene Name:  dynein, cytoplasmic 1, intermediate chain 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH013225.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002278

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1839nts         Open reading frame : 1 to 1839
Reference Sequence Alignment

ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTCCCTCCTCCTATG
TCTCCATCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGAT
GGCGCCGTGGGATCTAGACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTC
GACTTTCCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCT
CAACCCAAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAA
CCTGAAGAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCAT
GAGCTGACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTT
GACCATTCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGAC
TATAGTGGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCA
TTAAATCGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGAT
TGGTCATCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCT
CATGAGCCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAG
TATGTGTTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAAT
CTTGTTGTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAA
AGAACTCCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGT
GTAAATGTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAA
ATTTGTTCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCAT
AAACAGTCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAAC
TTTGTTGTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCT
GGAATCAGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCA
GCTGTTGGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTA
AAGCTTTGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTAT
GTTTATGATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATG
GGGAGATTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCT
GTGGAGGGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCT
GTGGGTGATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCC
CGCAATGATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCT
GATGCAGAGGAGGAAGCAGCTACCCGAATACCTGCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1923
Start on reference sequence 85
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : DYNC1I2
Symbol Nomenclature : DYNC1I2
SYNONYM : DNCI2; IC2
Designation : DH IC-2|cytoplasmic dynein 1 intermediate chain 2|dynein intermediate chain 2, cytosolic|dynein, cytoplasmic, intermediate polypeptide 2
Full Nomenclature : dynein, cytoplasmic 1, intermediate chain 2
GENEID : 1781
GI : 61370610
GenBank Accession : AY891597
HGNC : 2964
MIM : 603331
Vega : OTTHUMG00000154061
Target GenBank: BC015038

 

Reference Sequence Alignment

  

HsCD00002278        ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
XM_005246367.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001271788.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
XM_005246364.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001271790.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001271786.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001271789.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001271785.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001378.2         ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
XM_005246366.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
NM_001271787.1      ATGTCAGACAAAAGTGAATTAAAGGCTGAGTTGGAACGTAAGAAGCAGCGACTGGCCCAA
                    ************************************************************

HsCD00002278        ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
XM_005246367.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001271788.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
XM_005246364.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001271790.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001271786.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001271789.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001271785.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001378.2         ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
XM_005246366.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
NM_001271787.1      ATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAAGAAACAGACCAGAAG
                    ************************************************************

HsCD00002278        AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
XM_005246367.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001271788.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
XM_005246364.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001271790.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001271786.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001271789.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001271785.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001378.2         AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
XM_005246366.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
NM_001271787.1      AAGGAAGCTGTTGCTCCTGTGCAAGAAGAATCAGATCTTGAAAAAAAAAGGAGAGAAGCT
                    ************************************************************

HsCD00002278        GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTG--------------
XM_005246367.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTG--------------
NM_001271788.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTG--------------
XM_005246364.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGCTGAGCAACCTCTC
NM_001271790.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTG--------------
NM_001271786.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGCTGAGCAACCTCTC
NM_001271789.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTG--------------
NM_001271785.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTT------------
NM_001378.2         GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTT------------
XM_005246366.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTG--------------
NM_001271787.1      GAAGCATTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGCTGAGCAACCTCTC
                    **********************************************              

HsCD00002278        ----------------------------------------TCCCTCCTCCTATGTCTCCA
XM_005246367.1      ----------------------------------------TCCCTCCTCCTATGTCTCCA
NM_001271788.1      ----------------------------------------TCCCTCCTCCTATGTCTCCA
XM_005246364.1      CGTGTAGTAACAGCGGATACCTGTCTATTTCACTATTTAGTCCCTCCTCCTATGTCTCCA
NM_001271790.1      ----------------------------------------TCCCTCCTCCTATGTCTCCA
NM_001271786.1      CGTGTAGTAACAGCGGATACCTGTCTATTTCACTATTTAGTCCCTCCTCCTATGTCTCCA
NM_001271789.1      ----------------------------------------TCCCTCCTCCTATGTCTCCA
NM_001271785.1      ------------------------TTTTCTGAATACTGGGTCCCTCCTCCTATGTCTCCA
NM_001378.2         ------------------------TTTTCTGAATACTGGGTCCCTCCTCCTATGTCTCCA
XM_005246366.1      ----------------------------------------TCCCTCCTCCTATGTCTCCA
NM_001271787.1      CGTGTAGTAACAGCGGATACCTGTCTATTTCACTATTTAGTCCCTCCTCCTATGTCTCCA
                                                            ********************

HsCD00002278        TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
XM_005246367.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001271788.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
XM_005246364.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001271790.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001271786.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001271789.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001271785.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001378.2         TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
XM_005246366.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
NM_001271787.1      TCCTCCAAATCTGTGAGCACTCCAAGTGAAGCTGGAAGCCAAGACTCTGGAGATGGCGCC
                    ************************************************************

HsCD00002278        GTGGGATCTAG-------------------------------------------------
XM_005246367.1      GTGGGATCTAGGACGCTGCATTGGGATACAGATCCATCAGTTCTTCAGCTTCACTCAGAT
NM_001271788.1      GTGGGATCTAG-------------------------------------------------
XM_005246364.1      GTGGGATCTAGGACGCTGCATTGGGATACAGATCCATCAGTTCTTCAGCTTCACTCAGAT
NM_001271790.1      GTGGGATCTAG-------------------------------------------------
NM_001271786.1      GTGGGATCTAG-------------------------------------------------
NM_001271789.1      GTGGGATCTAG-------------------------------------------------
NM_001271785.1      GTGGGATCTAGGACGCTGCATTGGGATACAGATCCATCAGTTCTTCAGCTTCACTCAGAT
NM_001378.2         GTGGGATCTAGGACGCTGCATTGGGATACAGATCCATCAGTTCTTCAGCTTCACTCAGAT
XM_005246366.1      GTGGGATCTAGGACGCTGCATTGGGATACAGATCCATCAGTTCTTCAGCTTCACTCAGAT
NM_001271787.1      GTGGGATCTAG-------------------------------------------------
                    ***********                                                 

HsCD00002278        -----------ACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
XM_005246367.1      TCCGATTTGGGACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001271788.1      -----------ACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
XM_005246364.1      TCCGATTTGGGACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001271790.1      -----------ACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001271786.1      -----------ACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001271789.1      -----------ACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001271785.1      TCCGATTTGGGACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001378.2         TCCGATTTGGGACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
XM_005246366.1      TCCGATTTGGGACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
NM_001271787.1      -----------ACGAGGACCTATTAAACTTGGAATGGCTAAAATCACGCAAGTCGACTTT
                               *************************************************

HsCD00002278        CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
XM_005246367.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001271788.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
XM_005246364.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001271790.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001271786.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001271789.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001271785.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001378.2         CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
XM_005246366.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
NM_001271787.1      CCTCCTCGAGAAATTGTCACGTATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCC
                    ************************************************************

HsCD00002278        AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
XM_005246367.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001271788.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
XM_005246364.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001271790.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001271786.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001271789.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001271785.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001378.2         AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
XM_005246366.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
NM_001271787.1      AAAGAAGATGAAGAGGAAGATGATGATGTAGTGGCTCCTAAACCACCTATTGAACCTGAA
                    ************************************************************

HsCD00002278        GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
XM_005246367.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001271788.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
XM_005246364.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001271790.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001271786.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001271789.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001271785.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001378.2         GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
XM_005246366.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
NM_001271787.1      GAAGAGAAAACTTTAAAGAAAGATGAGGAAAATGATAGTAAAGCTCCCCCTCATGAGCTG
                    ************************************************************

HsCD00002278        ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
XM_005246367.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001271788.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
XM_005246364.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001271790.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001271786.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001271789.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001271785.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001378.2         ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
XM_005246366.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
NM_001271787.1      ACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAGGAATTTTTAAGTTTCTTTGACCAT
                    ************************************************************

HsCD00002278        TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
XM_005246367.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001271788.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
XM_005246364.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001271790.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001271786.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001271789.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001271785.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001378.2         TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
XM_005246366.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
NM_001271787.1      TCTACAAGAATTGTAGAAAGAGCTCTTTCTGAGCAGATTAACATCTTCTTTGACTATAGT
                    ************************************************************

HsCD00002278        GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
XM_005246367.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001271788.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
XM_005246364.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001271790.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001271786.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001271789.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001271785.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001378.2         GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
XM_005246366.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
NM_001271787.1      GGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAAT
                    ************************************************************

HsCD00002278        CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
XM_005246367.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001271788.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
XM_005246364.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001271790.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001271786.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001271789.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001271785.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001378.2         CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
XM_005246366.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
NM_001271787.1      CGACAATTTTTTGACGAACGTTGGTCAAAGCATCGGGTGGTTAGTTGTTTGGATTGGTCA
                    ************************************************************

HsCD00002278        TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
XM_005246367.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001271788.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
XM_005246364.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001271790.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001271786.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001271789.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001271785.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001378.2         TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
XM_005246366.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
NM_001271787.1      TCTCAGTATCCGGAGTTACTCGTGGCTTCCTATAACAACAATGAAGATGCCCCTCATGAG
                    ************************************************************

HsCD00002278        CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
XM_005246367.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001271788.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
XM_005246364.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001271790.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001271786.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001271789.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001271785.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001378.2         CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
XM_005246366.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
NM_001271787.1      CCTGATGGTGTGGCCCTTGTATGGAATATGAAATACAAAAAAACTACCCCAGAGTATGTG
                    ************************************************************

HsCD00002278        TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
XM_005246367.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001271788.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
XM_005246364.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001271790.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001271786.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001271789.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001271785.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001378.2         TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
XM_005246366.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
NM_001271787.1      TTTCACTGCCAGTCAGCTGTGATGTCTGCCACATTTGCAAAATTTCATCCAAATCTTGTT
                    ************************************************************

HsCD00002278        GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
XM_005246367.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001271788.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
XM_005246364.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001271790.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001271786.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001271789.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001271785.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001378.2         GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
XM_005246366.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
NM_001271787.1      GTTGGTGGTACATATTCAGGCCAAATTGTGCTTTGGGATAACCGTAGCAATAAAAGAACT
                    ************************************************************

HsCD00002278        CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
XM_005246367.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001271788.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
XM_005246364.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001271790.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001271786.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001271789.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001271785.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001378.2         CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
XM_005246366.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
NM_001271787.1      CCAGTGCAAAGAACTCCACTGTCAGCAGCTGCACACACACACCCTGTATATTGTGTAAAT
                    ************************************************************

HsCD00002278        GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
XM_005246367.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001271788.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
XM_005246364.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001271790.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001271786.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001271789.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001271785.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001378.2         GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
XM_005246366.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
NM_001271787.1      GTTGTTGGAACACAAAATGCTCACAATCTGATTAGCATCTCTACTGATGGAAAAATTTGT
                    ************************************************************

HsCD00002278        TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
XM_005246367.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001271788.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
XM_005246364.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001271790.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001271786.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001271789.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001271785.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001378.2         TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
XM_005246366.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
NM_001271787.1      TCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAGTTGGTTCATAAACAG
                    ************************************************************

HsCD00002278        TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
XM_005246367.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001271788.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
XM_005246364.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001271790.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001271786.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001271789.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001271785.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001378.2         TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
XM_005246366.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
NM_001271787.1      TCAAAAGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTT
                    ************************************************************

HsCD00002278        GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
XM_005246367.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001271788.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
XM_005246364.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001271790.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001271786.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001271789.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001271785.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001378.2         GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
XM_005246366.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
NM_001271787.1      GTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGCCGCCATGGCAGCAAAGCTGGAATC
                    ************************************************************

HsCD00002278        AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
XM_005246367.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001271788.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
XM_005246364.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001271790.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001271786.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001271789.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001271785.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001378.2         AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
XM_005246366.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
NM_001271787.1      AGTGAGATGTTTGAGGGGCATCAAGGACCAATCACTGGCATCCATTGTCATGCAGCTGTT
                    ************************************************************

HsCD00002278        GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
XM_005246367.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001271788.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
XM_005246364.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001271790.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001271786.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001271789.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001271785.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001378.2         GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
XM_005246366.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
NM_001271787.1      GGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCGTTTGACTGGACAGTAAAGCTT
                    ************************************************************

HsCD00002278        TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
XM_005246367.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001271788.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
XM_005246364.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001271790.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001271786.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001271789.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001271785.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001378.2         TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
XM_005246366.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
NM_001271787.1      TGGACAACTAAGAATAACAAGCCTTTGTATTCATTTGAAGATAATGCAGACTATGTTTAT
                    ************************************************************

HsCD00002278        GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
XM_005246367.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001271788.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
XM_005246364.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001271790.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001271786.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001271789.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001271785.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001378.2         GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
XM_005246366.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
NM_001271787.1      GATGTTATGTGGTCACCTACCCACCCAGCCCTGTTTGCCTGTGTGGATGGCATGGGGAGA
                    ************************************************************

HsCD00002278        TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
XM_005246367.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001271788.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
XM_005246364.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001271790.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001271786.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001271789.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001271785.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001378.2         TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
XM_005246366.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
NM_001271787.1      TTGGATTTGTGGAATCTCAATAATGACACAGAGGTACCAACTGCCAGCATTTCTGTGGAG
                    ************************************************************

HsCD00002278        GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
XM_005246367.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001271788.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
XM_005246364.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001271790.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001271786.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001271789.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001271785.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001378.2         GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
XM_005246366.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
NM_001271787.1      GGTAATCCTGCTCTTAATCGTGTGAGATGGACCCATTCTGGCAGAGAGATTGCTGTGGGT
                    ************************************************************

HsCD00002278        GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
XM_005246367.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
NM_001271788.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
XM_005246364.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
NM_001271790.1      GATTCTGAAGGACAGATTGTTATATACGATGTG---GGAGAGATTGCTGTTCCCCGCAAT
NM_001271786.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
NM_001271789.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
NM_001271785.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
NM_001378.2         GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
XM_005246366.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
NM_001271787.1      GATTCTGAAGGACAGATTGTTATATACGATGTGGGAGAGCAGATTGCTGTTCCCCGCAAT
                    *********************************   *.. ********************

HsCD00002278        GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
XM_005246367.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001271788.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
XM_005246364.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001271790.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001271786.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001271789.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001271785.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001378.2         GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
XM_005246366.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
NM_001271787.1      GATGAATGGGCACGGTTTGGCCGAACACTTGCAGAAATTAATGCAAACCGAGCTGATGCA
                    ************************************************************

HsCD00002278        GAGGAGGAAGCAGCTACCCGAATACCTGCTTTG
XM_005246367.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001271788.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
XM_005246364.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001271790.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001271786.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001271789.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001271785.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001378.2         GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
XM_005246366.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
NM_001271787.1      GAGGAGGAAGCAGCTACCCGAATACCTGCTTAG
                    *******************************:*

Pathways

Panther : Huntington disease
Reactome : Adaptive Immune System
Reactome : Cell Cycle
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : G2/M Transition
Reactome : Immune System
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : MHC class II antigen presentation
Reactome : Mitotic G2-G2/M phases
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of PLK1 Activity at G2/M Transition

Protein

SMART domain : WD40 : WD40 repeats
UniProt : Q13409
HPRD : 04512

Clone

Cloning Information : 13225
HIP Master Clone ID : 27424
Original Clone ID : FLH013225.01L

Organism


TAX_ID : 9606
Species Specific ID: 1781

Genome

Chromosome : 2
Map Location : 2q31.1
Ensembl : ENSG00000077380

Reagents

Labome : DYNC1I2-antibody