DNASU Plasmid Repository • 480.965.5697 | Email

SLBP (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  SLBP
Gene Name:  stem-loop binding protein
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015556.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002317

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 813nts         Open reading frame : 1 to 813
Reference Sequence Alignment

ATGGCCTGCCGCCCGCGAAGCCCGCCGAGGCATCAGAGCCGCTGCGACGGTGACGCCAGC
CCGCCGTCCCCCGCGCGATGGAGCCTGGGACGGAAGCGCAGAGCCGACGGCAGGCGCTGG
AGGCCCGAAGACGCCGAGGAGGCAGAGCACCGCGGCGCCGAGCGCAGACCCGAGAGCTTT
ACCACTCCTGAAGGCCCTAAACCCCGTTCCAGATGCTCTGACTGGGCAAGTGCAGTTGAA
GAAGATGAAATGAGGACCAGAGTTAACAAAGAAATGGCAAGATATAAAAGGAAACTCCTC
ATCAATGACTTTGGAAGAGAGAGAAAATCATCATCAGGAAGTTCTGATTCAAAGGAGTCT
ATGTCTACTGTGCCGGCTGACTTTGAGACAGATGAAAGTGTCCTAATGAGGAGACAGAAG
CAGATCAACTATGGGAAGAACACAATTGCCTACGATCGTTATATTAAAGAAGTCCCAAGA
CACCTTCGACAACCTGGCATTCATCCCAAGACCCCTAATAAATTTAAGAAGTATAGTCGA
CGTTCATGGGACCAGCAAATCAAACTCTGGAAGGTGGCTCTGCATTTTTGGGATCCTCCA
GCGGAAGAAGGATGTGATTTGCAAGAAATACACCCTGTAGACCTTGAATCTGCAGAAAGC
AGCTCCGAGCCCCAGACCAGCTCTCAGGATGACTTTGATGTGTACTCTGGCACACCCACC
AAGGTGAGACACATGGACAGTCAAGTGGAGGATGAGTTTGATTTGGAAGCTTGTTTAACT
GAACCCTTGAGAGACTTCTCAGCCATGAGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 935
Start on reference sequence 123
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : SLBP
Symbol Nomenclature : SLBP
SYNONYM : HBP
Designation : hairpin binding protein, histone|histone RNA hairpin-binding protein|histone binding protein|histone stem-loop binding protein|histone stem-loop-binding protein|stem-loop (histone) binding protein
Full Nomenclature : stem-loop binding protein
GENEID : 7884
GI : 61360998
GenBank Accession : AY889027
HGNC : 10904
MIM : 602422
Vega : OTTHUMG00000089349
Target GenBank: BC014908

 

Reference Sequence Alignment

  

HsCD00002317      ATGGCCTGCCGCCCGCGAAGCCCGCCGAGGCATCAGAGCCGCTGCGACGGTGACGCCAGC
NM_006527.2       ATGGCCTGCCGCCCGCGAAGCCCGCCGAGGCATCAGAGCCGCTGCGACGGTGACGCCAGC
                  ************************************************************

HsCD00002317      CCGCCGTCCCCCGCGCGATGGAGCCTGGGACGGAAGCGCAGAGCCGACGGCAGGCGCTGG
NM_006527.2       CCGCCGTCCCCCGCGCGATGGAGCCTGGGACGGAAGCGCAGAGCCGACGGCAGGCGCTGG
                  ************************************************************

HsCD00002317      AGGCCCGAAGACGCCGAGGAGGCAGAGCACCGCGGCGCCGAGCGCAGACCCGAGAGCTTT
NM_006527.2       AGGCCCGAAGACGCCGAGGAGGCAGAGCACCGCGGCGCCGAGCGCAGACCCGAGAGCTTT
                  ************************************************************

HsCD00002317      ACCACTCCTGAAGGCCCTAAACCCCGTTCCAGATGCTCTGACTGGGCAAGTGCAGTTGAA
NM_006527.2       ACCACTCCTGAAGGCCCTAAACCCCGTTCCAGATGCTCTGACTGGGCAAGTGCAGTTGAA
                  ************************************************************

HsCD00002317      GAAGATGAAATGAGGACCAGAGTTAACAAAGAAATGGCAAGATATAAAAGGAAACTCCTC
NM_006527.2       GAAGATGAAATGAGGACCAGAGTTAACAAAGAAATGGCAAGATATAAAAGGAAACTCCTC
                  ************************************************************

HsCD00002317      ATCAATGACTTTGGAAGAGAGAGAAAATCATCATCAGGAAGTTCTGATTCAAAGGAGTCT
NM_006527.2       ATCAATGACTTTGGAAGAGAGAGAAAATCATCATCAGGAAGTTCTGATTCAAAGGAGTCT
                  ************************************************************

HsCD00002317      ATGTCTACTGTGCCGGCTGACTTTGAGACAGATGAAAGTGTCCTAATGAGGAGACAGAAG
NM_006527.2       ATGTCTACTGTGCCGGCTGACTTTGAGACAGATGAAAGTGTCCTAATGAGGAGACAGAAG
                  ************************************************************

HsCD00002317      CAGATCAACTATGGGAAGAACACAATTGCCTACGATCGTTATATTAAAGAAGTCCCAAGA
NM_006527.2       CAGATCAACTATGGGAAGAACACAATTGCCTACGATCGTTATATTAAAGAAGTCCCAAGA
                  ************************************************************

HsCD00002317      CACCTTCGACAACCTGGCATTCATCCCAAGACCCCTAATAAATTTAAGAAGTATAGTCGA
NM_006527.2       CACCTTCGACAACCTGGCATTCATCCCAAGACCCCTAATAAATTTAAGAAGTATAGTCGA
                  ************************************************************

HsCD00002317      CGTTCATGGGACCAGCAAATCAAACTCTGGAAGGTGGCTCTGCATTTTTGGGATCCTCCA
NM_006527.2       CGTTCATGGGACCAGCAAATCAAACTCTGGAAGGTGGCTCTGCATTTTTGGGATCCTCCA
                  ************************************************************

HsCD00002317      GCGGAAGAAGGATGTGATTTGCAAGAAATACACCCTGTAGACCTTGAATCTGCAGAAAGC
NM_006527.2       GCGGAAGAAGGATGTGATTTGCAAGAAATACACCCTGTAGACCTTGAATCTGCAGAAAGC
                  ************************************************************

HsCD00002317      AGCTCCGAGCCCCAGACCAGCTCTCAGGATGACTTTGATGTGTACTCTGGCACACCCACC
NM_006527.2       AGCTCCGAGCCCCAGACCAGCTCTCAGGATGACTTTGATGTGTACTCTGGCACACCCACC
                  ************************************************************

HsCD00002317      AAGGTGAGACACATGGACAGTCAAGTGGAGGATGAGTTTGATTTGGAAGCTTGTTTAACT
NM_006527.2       AAGGTGAGACACATGGACAGTCAAGTGGAGGATGAGTTTGATTTGGAAGCTTGTTTAACT
                  ************************************************************

HsCD00002317      GAACCCTTGAGAGACTTCTCAGCCATGAGCTAG
NM_006527.2       GAACCCTTGAGAGACTTCTCAGCCATGAGCTAA
                  ********************************.

Pathways

Reactome : Cleavage of Growing Transcript in the Termination Region
Reactome : Gene Expression
Reactome : Post-Elongation Processing of Intronless pre-mRNA
Reactome : Post-Elongation Processing of the Transcript
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Processing of Capped Intronless Pre-mRNA
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Termination
Reactome : SLBP Dependent Processing of Replication-Dependent Histone Pre-mRNAs
Reactome : Transcription
Reactome : Transport of Mature Transcript to Cytoplasm
Reactome : Transport of Mature mRNAs Derived from Intronless Transcripts
Reactome : Transport of the SLBP Dependant Mature mRNA

Protein

UniProt : Q53XR2
UniProt : Q14493
HPRD : 03884

Clone

Cloning Information : 15556
HIP Master Clone ID : 29755
Original Clone ID : FLH015556.01X

Organism


TAX_ID : 9606
Species Specific ID: 7884

Genome

Chromosome : 4
Map Location : 4p16.3
Ensembl : ENSG00000163950

Reagents

Labome : SLBP-antibody