DNASU Plasmid Repository • 480.965.5697 | Email

CDC2 (Homo sapiens) in pDONR201 (Gateway donor/master vector)


Explanation of Terms

Gene: Gene Symbol:  CDK1
Gene Name:  cyclin-dependent kinase 1
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH058698.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP

Price:  Login for Pricing
No restriction
Special MTA: None


Insert sequence: 894nts         Open reading frame : 1 to 894
Reference Sequence Alignment


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1020
Start on reference sequence 127
5' Linker Sequence:

3' Linker Sequence:


 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:


Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5’ tcgcgttaacgctagcatggatctc 3’ 300 324
primer site reverse primer recommended reverse primer site 5’ gtaacatcagagattttgagacac 3’ 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275


  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents



Gene Symbol : CDK1
Symbol Nomenclature : CDK1
Designation : cell cycle controller CDC2|cell division control protein 2 homolog|cell division cycle 2, G1 to S and G2 to M|cell division protein kinase 1|p34 protein kinase
Full Nomenclature : cyclin-dependent kinase 1
GENEID : 983
GI : 60813868
GenBank Accession : AY893241
HGNC : 1722
MIM : 116940
Vega : OTTHUMG00000018290
Target GenBank: NM_001786


Reference Sequence Alignment


















NCI : AP-1 transcription factor network
NCI : E2F transcription factor network
NCI : FOXM1 transcription factor network
NCI : PLK1 signaling events
NCI : Retinoic acid receptors-mediated signaling
NCI : p73 transcription factor network
Reactome : APC/C-mediated degradation of cell cycle proteins
Reactome : APC/C:Cdc20 mediated degradation of Cyclin B
Reactome : APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : ARMS-mediated activation
Reactome : Activated TLR4 signalling
Reactome : Activation of APC/C and APC/C:Cdc20 mediated degradation of mitotic proteins
Reactome : Activation of NIMA Kinases NEK9, NEK6, NEK7
Reactome : Axon guidance
Reactome : Cdc20:Phospho-APC/C mediated degradation of Cyclin A
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Centrosome maturation
Reactome : Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex
Reactome : Condensation of Prometaphase Chromosomes
Reactome : Condensation of Prophase Chromosomes
Reactome : Cyclin A/B1 associated events during G2/M transition
Reactome : Cyclin B2 mediated events
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Depolymerisation of the Nuclear Lamina
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling of activated FGFR
Reactome : E2F mediated regulation of DNA replication
Reactome : E2F-enabled inhibition of pre-replication complex formation
Reactome : ERK activation
Reactome : ERK1 activation
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : G0 and Early G1
Reactome : G1/S Transition
Reactome : G1/S-Specific Transcription
Reactome : G2/M Checkpoints
Reactome : G2/M DNA damage checkpoint
Reactome : G2/M DNA replication checkpoint
Reactome : G2/M Transition
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Golgi Cisternae Pericentriolar Stack Reorganization
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : Loss of Nlp from mitotic centrosomes
Reactome : Loss of proteins required for interphase microtubule organizationÿ from the centrosome
Reactome : M Phase
Reactome : MAP kinase activation in TLR cascade
Reactome : MASTL Facilitates Mitotic Progression
Reactome : Mitotic G1-G1/S phases
Reactome : Mitotic G2-G2/M phases
Reactome : Mitotic M-M/G1 phases
Reactome : Mitotic Prometaphase
Reactome : Mitotic Prophase
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Nuclear Envelope Breakdown
Reactome : Nuclear Pore Complex (NPC) Disassembly
Reactome : Phosphorylation of Emi1
Reactome : Phosphorylation of proteins involved in the G2/M transition by Cyclin A:Cdc2 complexes
Reactome : Phosphorylation of the APC/C
Reactome : Prolonged ERK activation events
Reactome : RAF/MAP kinase cascade
Reactome : Recruitment of NuMA to mitotic centrosomes
Reactome : Recruitment of mitotic centrosome proteins and complexes
Reactome : Regulation of APC/C activators between G1/S and early anaphase
Reactome : Regulation of PLK1 Activity at G2/M Transition
Reactome : Regulation of mitotic cell cycle
Reactome : Resolution of Sister Chromatid Cohesion
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
WikiPathway : Cell cycle
WikiPathway : DNA damage response
WikiPathway : G1 to S cell cycle control
WikiPathway : Integrated Cancer pathway
WikiPathway : TGF beta Signaling Pathway
WikiPathway : miRNA regulation of DNA Damage Response


SMART domain : S_TKc : Serine/Threonine protein kinases, catalytic domain
SMART domain : TyrKc : Tyrosine kinase, catalytic domain
UniProt : B7Z3D6
UniProt : P06493
HPRD : 00302


Cloning Information : 58698
HIP Master Clone ID : 39258
Original Clone ID : FLH058698.01X


TAX_ID : 9606
Species Specific ID: 983


Chromosome : 10
Map Location : 10q21.1
Ensembl : ENSG00000170312


Labome : Cdc2-antibody