DNASU Plasmid Repository • 480.965.5697 | Email

PLAU (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PLAU
Gene Name:  plasminogen activator, urokinase
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026743.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002383

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1296nts         Open reading frame : 1 to 1296
Reference Sequence Alignment

ATGAGAGCCCTGCTGGCGCGCCTGCTTCTCTGCGTCCTGGTCGTGAGCGACTCCAAAGGC
AGCAATGAACTTCATCAAGTTCCATCGAACTGTGACTGTCTAAATGGAGGAACATGTGTG
TCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTCGGAGGGCAG
CACTGTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTTTACCGAGGA
AAGGCCAGCACTGACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCCACTGTCCTT
CAGCAAACGTACCATGCCCACAGATCTGATGCTCTTCAGCTGGGCCTGGGGAAACATAAT
TACTGCAGGAACCCAGACAACCGGAGGCGACCCTGGTGCTATGTGCAGGTGGGCCTAAAG
CCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATGGAAAAAAGCCCTCCTCTCCT
CCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCTTTAAGATTATT
GGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTACAGGAGGCAC
CGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGCTGGGTGATC
AGCGCCACACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTCTACCTGGGT
CGCTCAAGGCTTAACTCCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAAAACCTCATC
CTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAG
ATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTG
CCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAA
GAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATT
TCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTG
TGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTC
GTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGCCGTGGATGT
GCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCCTGGATCCGC
AGTCACACCAAGGAAGAGAATGGCCTGGCCCTCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1400
Start on reference sequence 105
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PLAU
Symbol Nomenclature : PLAU
SYNONYM : ATF; BDPLT5; QPD; UPA; URK; u-PA
Designation : U-plasminogen activator|plasminogen activator, urinary|urokinase-type plasminogen activator
Full Nomenclature : plasminogen activator, urokinase
GENEID : 5328
Locus Tag : RP11-417O11.1
GI : 60654570
GenBank Accession : AY889059
HGNC : 9052
MIM : 191840
Vega : OTTHUMG00000018494
Target GenBank: BC013575

 

Reference Sequence Alignment

  

HsCD00002383        ATGAGAGCCCTGCTGGCGCGCCTGCTTCTCTGCGTCCTGGTCGTGAGCGACTCCAAAGGC
NM_001145031.1      ---------------------------------------------------ATGGTCTTC
NM_002658.3         ATGAGAGCCCTGCTGGCGCGCCTGCTTCTCTGCGTCCTGGTCGTGAGCGACTCCAAAGGC
                                                                       :  .:.  *

HsCD00002383        AGCAATGAACTTCATCAAGTTCCATCGAACTGTGACTGTCTAAATGGAGGAACATGTGTG
NM_001145031.1      CATTTGAGAACTAGATACGAACAGGCGAACTGTGACTGTCTAAATGGAGGAACATGTGTG
NM_002658.3         AGCAATGAACTTCATCAAGTTCCATCGAACTGTGACTGTCTAAATGGAGGAACATGTGTG
                    .. :: ..*. *..: *.*::*.. ***********************************

HsCD00002383        TCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTCGGAGGGCAG
NM_001145031.1      TCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTCGGAGGGCAG
NM_002658.3         TCCAACAAGTACTTCTCCAACATTCACTGGTGCAACTGCCCAAAGAAATTCGGAGGGCAG
                    ************************************************************

HsCD00002383        CACTGTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTTTACCGAGGA
NM_001145031.1      CACTGTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTTTACCGAGGA
NM_002658.3         CACTGTGAAATAGATAAGTCAAAAACCTGCTATGAGGGGAATGGTCACTTTTACCGAGGA
                    ************************************************************

HsCD00002383        AAGGCCAGCACTGACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCCACTGTCCTT
NM_001145031.1      AAGGCCAGCACTGACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCCACTGTCCTT
NM_002658.3         AAGGCCAGCACTGACACCATGGGCCGGCCCTGCCTGCCCTGGAACTCTGCCACTGTCCTT
                    ************************************************************

HsCD00002383        CAGCAAACGTACCATGCCCACAGATCTGATGCTCTTCAGCTGGGCCTGGGGAAACATAAT
NM_001145031.1      CAGCAAACGTACCATGCCCACAGATCTGATGCTCTTCAGCTGGGCCTGGGGAAACATAAT
NM_002658.3         CAGCAAACGTACCATGCCCACAGATCTGATGCTCTTCAGCTGGGCCTGGGGAAACATAAT
                    ************************************************************

HsCD00002383        TACTGCAGGAACCCAGACAACCGGAGGCGACCCTGGTGCTATGTGCAGGTGGGCCTAAAG
NM_001145031.1      TACTGCAGGAACCCAGACAACCGGAGGCGACCCTGGTGCTATGTGCAGGTGGGCCTAAAG
NM_002658.3         TACTGCAGGAACCCAGACAACCGGAGGCGACCCTGGTGCTATGTGCAGGTGGGCCTAAAG
                    ************************************************************

HsCD00002383        CCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATGGAAAAAAGCCCTCCTCTCCT
NM_001145031.1      CCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATGGAAAAAAGCCCTCCTCTCCT
NM_002658.3         CCGCTTGTCCAAGAGTGCATGGTGCATGACTGCGCAGATGGAAAAAAGCCCTCCTCTCCT
                    ************************************************************

HsCD00002383        CCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCTTTAAGATTATT
NM_001145031.1      CCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCTTTAAGATTATT
NM_002658.3         CCAGAAGAATTAAAATTTCAGTGTGGCCAAAAGACTCTGAGGCCCCGCTTTAAGATTATT
                    ************************************************************

HsCD00002383        GGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTACAGGAGGCAC
NM_001145031.1      GGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTACAGGAGGCAC
NM_002658.3         GGGGGAGAATTCACCACCATCGAGAACCAGCCCTGGTTTGCGGCCATCTACAGGAGGCAC
                    ************************************************************

HsCD00002383        CGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGCTGGGTGATC
NM_001145031.1      CGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGCTGGGTGATC
NM_002658.3         CGGGGGGGCTCTGTCACCTACGTGTGTGGAGGCAGCCTCATCAGCCCTTGCTGGGTGATC
                    ************************************************************

HsCD00002383        AGCGCCACACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTCTACCTGGGT
NM_001145031.1      AGCGCCACACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTCTACCTGGGT
NM_002658.3         AGCGCCACACACTGCTTCATTGATTACCCAAAGAAGGAGGACTACATCGTCTACCTGGGT
                    ************************************************************

HsCD00002383        CGCTCAAGGCTTAACTCCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAAAACCTCATC
NM_001145031.1      CGCTCAAGGCTTAACTCCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAAAACCTCATC
NM_002658.3         CGCTCAAGGCTTAACTCCAACACGCAAGGGGAGATGAAGTTTGAGGTGGAAAACCTCATC
                    ************************************************************

HsCD00002383        CTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAG
NM_001145031.1      CTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAG
NM_002658.3         CTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAG
                    ************************************************************

HsCD00002383        ATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTG
NM_001145031.1      ATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTG
NM_002658.3         ATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTG
                    ************************************************************

HsCD00002383        CCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAA
NM_001145031.1      CCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAA
NM_002658.3         CCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAA
                    ************************************************************

HsCD00002383        GAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATT
NM_001145031.1      GAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATT
NM_002658.3         GAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATT
                    ************************************************************

HsCD00002383        TCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTG
NM_001145031.1      TCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTG
NM_002658.3         TCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTG
                    ************************************************************

HsCD00002383        TGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTC
NM_001145031.1      TGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTC
NM_002658.3         TGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTC
                    ************************************************************

HsCD00002383        GTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGCCGTGGATGT
NM_001145031.1      GTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGCCGTGGATGT
NM_002658.3         GTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGGGGCCGTGGATGT
                    ************************************************************

HsCD00002383        GCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCCTGGATCCGC
NM_001145031.1      GCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCCTGGATCCGC
NM_002658.3         GCCCTGAAGGACAAGCCAGGCGTCTACACGAGAGTCTCACACTTCTTACCCTGGATCCGC
                    ************************************************************

HsCD00002383        AGTCACACCAAGGAAGAGAATGGCCTGGCCCTCTAG
NM_001145031.1      AGTCACACCAAGGAAGAGAATGGCCTGGCCCTCTGA
NM_002658.3         AGTCACACCAAGGAAGAGAATGGCCTGGCCCTCTGA
                    **********************************..

Pathways

NCI : AP-1 transcription factor network
NCI : ATF-2 transcription factor network
NCI : Beta1 integrin cell surface interactions
NCI : Beta2 integrin cell surface interactions
NCI : Beta3 integrin cell surface interactions
NCI : Beta5 beta6 beta7 and beta8 integrin cell surface interactions
NCI : E2F transcription factor network
NCI : FGF signaling pathway
NCI : Osteopontin-mediated events
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : Validated transcriptional targets of AP1 family members Fra1 and Fra2
NCI : amb2 Integrin signaling
Panther : Blood coagulation
Panther : Plasminogen activating cascade
Reactome : Dissolution of Fibrin Clot
Reactome : Hemostasis
WikiPathway : Blood Clotting Cascade
WikiPathway : Complement and Coagulation Cascades
WikiPathway : DNA damage response (only ATM dependent)
WikiPathway : Endochondral Ossification
WikiPathway : Osteopontin Signaling
WikiPathway : Wnt Signaling Pathway
WikiPathway : Wnt Signaling Pathway and Pluripotency

Protein

SMART domain : KR : Kringle domain
SMART domain : Tryp_SPc : Trypsin-like serine protease
UniProt : Q59GZ8
UniProt : P00749
HPRD : 01883

Clone

Cloning Information : 26743
HIP Master Clone ID : 57119
Original Clone ID : FLH026743.01X

Organism


TAX_ID : 9606
Species Specific ID: 5328

Genome

Chromosome : 10
Map Location : 10q22.2
Ensembl : ENSG00000122861

Reagents

Labome : uPA-antibody