DNASU Plasmid Repository • 480.965.5697 | Email

GNA15 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  GNA15
Gene Name:  guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH110050.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002418

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1125nts         Open reading frame : 1 to 1125
Reference Sequence Alignment

ATGGCCCGCTCGCTGACCTGGCGCTGCTGCCCCTGGTGCCTGACGGAGGATGAGAAGGCC
GCCGCCCGGGTGGACCAGGAGATCAACAGGATCCTCTTGGAGCAGAAGAAGCAGGACCGC
GGGGAGCTGAAGCTGCTGCTTTTGGGCCCAGGCGAGAGCGGGAAGAGCACCTTCATCAAG
CAGATGCGGATCATCCACGGCGCCGGCTACTCGGAGGAGGAGCGCAAGGGCTTCCGGCCC
CTGGTCTACCAGAACATCTTCGTGTCCATGCGGGCCATGATCGAGGCCATGGAGCGGCTG
CAGATTCCATTCAGCAGGCCCGAGAGCAAGCACCACGCTAGCCTGGTCATGAGCCAGGAC
CCCTATAAAGTGACCACGTTTGAGAAGCGCTACGCTGCGGCCATGCAGTGGCTGTGGAGG
GATGCCGGCATCCGGGCCTGCTATGAGCGTCGGCGGGAATTCCACCTGCTCGATTCAGCC
GTGTACTACCTGTCCCACCTGGAGCGCATCACCGAGGAGGGCTACGTCCCCACAGCTCAG
GACGTGCTCCGCAGCCGCATGCCCACCACTGGCATCAACGAGTACTGCTTCTCCGTGCAG
AAAACCAACCTGCGGATCGTGGACGTCGGGGGCCAGAAGTCAGAGCGTAAGAAATGGATC
CATTGTTTCGAGAACGTGATCGCCCTCATCTACCTGGCCTCACTGAGTGAATACGACCAG
TGCCTGGAGGAGAACAACCAGGAGAACCGCATGAAGGAGAGCCTCGCATTGTTTGGGACT
ATCCTGGAACTACCCTGGTTCAAAAGCACATCCGTCATCCTCTTTCTCAACAAAACCGAC
ATCCTGGAGGAGAAAATCCCCACCTCCCACCTGGCTACCTATTTCCCCAGTTTCCAGGGC
CCTAAGCAGGATGCTGAGGCAGCCAAGAGGTTCATCCTGGACATGTACACGAGGATGTAC
ACCGGGTGCGTGGACGGCCCCGAGGGCAGCAAGAAGGGCGCACGATCCCGACGCCTCTTC
AGCCACTACACATGTGCCACAGACACACAGAACATCCGCAAGGTCTTCAAGGACGTGCGG
GACTCGGTGCTCGCCCGCTACCTGGACGAGATCAACCTGCTGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1310
Start on reference sequence 186
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : GNA15
Symbol Nomenclature : GNA15
SYNONYM : GNA16
Designation : G-protein subunit alpha-15|G-protein subunit alpha-16|epididymis tissue protein Li 17E|g alpha-15|g alpha-16|guanine nucleotide-binding protein subunit alpha-15|guanine nucleotide-binding protein subunit alpha-16
Full Nomenclature : guanine nucleotide binding protein (G protein), alpha 15 (Gq class)
GENEID : 2769
GI : 60654622
GenBank Accession : AY889085
HGNC : 4383
MIM : 139314
Vega : OTTHUMG00000180637
Target GenBank: BC013585

 

Reference Sequence Alignment

  

HsCD00002418      ATGGCCCGCTCGCTGACCTGGCGCTGCTGCCCCTGGTGCCTGACGGAGGATGAGAAGGCC
NM_002068.2       ATGGCCCGCTCGCTGACCTGGCGCTGCTGCCCCTGGTGCCTGACGGAGGATGAGAAGGCC
                  ************************************************************

HsCD00002418      GCCGCCCGGGTGGACCAGGAGATCAACAGGATCCTCTTGGAGCAGAAGAAGCAGGACCGC
NM_002068.2       GCCGCCCGGGTGGACCAGGAGATCAACAGGATCCTCTTGGAGCAGAAGAAGCAGGACCGC
                  ************************************************************

HsCD00002418      GGGGAGCTGAAGCTGCTGCTTTTGGGCCCAGGCGAGAGCGGGAAGAGCACCTTCATCAAG
NM_002068.2       GGGGAGCTGAAGCTGCTGCTTTTGGGCCCAGGCGAGAGCGGGAAGAGCACCTTCATCAAG
                  ************************************************************

HsCD00002418      CAGATGCGGATCATCCACGGCGCCGGCTACTCGGAGGAGGAGCGCAAGGGCTTCCGGCCC
NM_002068.2       CAGATGCGGATCATCCACGGCGCCGGCTACTCGGAGGAGGAGCGCAAGGGCTTCCGGCCC
                  ************************************************************

HsCD00002418      CTGGTCTACCAGAACATCTTCGTGTCCATGCGGGCCATGATCGAGGCCATGGAGCGGCTG
NM_002068.2       CTGGTCTACCAGAACATCTTCGTGTCCATGCGGGCCATGATCGAGGCCATGGAGCGGCTG
                  ************************************************************

HsCD00002418      CAGATTCCATTCAGCAGGCCCGAGAGCAAGCACCACGCTAGCCTGGTCATGAGCCAGGAC
NM_002068.2       CAGATTCCATTCAGCAGGCCCGAGAGCAAGCACCACGCTAGCCTGGTCATGAGCCAGGAC
                  ************************************************************

HsCD00002418      CCCTATAAAGTGACCACGTTTGAGAAGCGCTACGCTGCGGCCATGCAGTGGCTGTGGAGG
NM_002068.2       CCCTATAAAGTGACCACGTTTGAGAAGCGCTACGCTGCGGCCATGCAGTGGCTGTGGAGG
                  ************************************************************

HsCD00002418      GATGCCGGCATCCGGGCCTGCTATGAGCGTCGGCGGGAATTCCACCTGCTCGATTCAGCC
NM_002068.2       GATGCCGGCATCCGGGCCTACTATGAGCGTCGGCGGGAATTCCACCTGCTCGATTCAGCC
                  *******************.****************************************

HsCD00002418      GTGTACTACCTGTCCCACCTGGAGCGCATCACCGAGGAGGGCTACGTCCCCACAGCTCAG
NM_002068.2       GTGTACTACCTGTCCCACCTGGAGCGCATCACCGAGGAGGGCTACGTCCCCACAGCTCAG
                  ************************************************************

HsCD00002418      GACGTGCTCCGCAGCCGCATGCCCACCACTGGCATCAACGAGTACTGCTTCTCCGTGCAG
NM_002068.2       GACGTGCTCCGCAGCCGCATGCCCACCACTGGCATCAACGAGTACTGCTTCTCCGTGCAG
                  ************************************************************

HsCD00002418      AAAACCAACCTGCGGATCGTGGACGTCGGGGGCCAGAAGTCAGAGCGTAAGAAATGGATC
NM_002068.2       AAAACCAACCTGCGGATCGTGGACGTCGGGGGCCAGAAGTCAGAGCGTAAGAAATGGATC
                  ************************************************************

HsCD00002418      CATTGTTTCGAGAACGTGATCGCCCTCATCTACCTGGCCTCACTGAGTGAATACGACCAG
NM_002068.2       CATTGTTTCGAGAACGTGATCGCCCTCATCTACCTGGCCTCACTGAGTGAATACGACCAG
                  ************************************************************

HsCD00002418      TGCCTGGAGGAGAACAACCAGGAGAACCGCATGAAGGAGAGCCTCGCATTGTTTGGGACT
NM_002068.2       TGCCTGGAGGAGAACAACCAGGAGAACCGCATGAAGGAGAGCCTCGCATTGTTTGGGACT
                  ************************************************************

HsCD00002418      ATCCTGGAACTACCCTGGTTCAAAAGCACATCCGTCATCCTCTTTCTCAACAAAACCGAC
NM_002068.2       ATCCTGGAACTACCCTGGTTCAAAAGCACATCCGTCATCCTCTTTCTCAACAAAACCGAC
                  ************************************************************

HsCD00002418      ATCCTGGAGGAGAAAATCCCCACCTCCCACCTGGCTACCTATTTCCCCAGTTTCCAGGGC
NM_002068.2       ATCCTGGAGGAGAAAATCCCCACCTCCCACCTGGCTACCTATTTCCCCAGTTTCCAGGGC
                  ************************************************************

HsCD00002418      CCTAAGCAGGATGCTGAGGCAGCCAAGAGGTTCATCCTGGACATGTACACGAGGATGTAC
NM_002068.2       CCTAAGCAGGATGCTGAGGCAGCCAAGAGGTTCATCCTGGACATGTACACGAGGATGTAC
                  ************************************************************

HsCD00002418      ACCGGGTGCGTGGACGGCCCCGAGGGCAGCAAGAAGGGCGCACGATCCCGACGCCTCTTC
NM_002068.2       ACCGGGTGCGTGGACGGCCCCGAGGGCAGCAAGAAGGGCGCACGATCCCGACGCCTCTTC
                  ************************************************************

HsCD00002418      AGCCACTACACATGTGCCACAGACACACAGAACATCCGCAAGGTCTTCAAGGACGTGCGG
NM_002068.2       AGCCACTACACATGTGCCACAGACACACAGAACATCCGCAAGGTCTTCAAGGACGTGCGG
                  ************************************************************

HsCD00002418      GACTCGGTGCTCGCCCGCTACCTGGACGAGATCAACCTGCTGTAG
NM_002068.2       GACTCGGTGCTCGCCCGCTACCTGGACGAGATCAACCTGCTGTGA
                  *******************************************..

Pathways

NCI : Arf6 signaling events
NCI : Endothelins
NCI : IL8- and CXCR1-mediated signaling events
NCI : IL8- and CXCR2-mediated signaling events
NCI : LPA receptor mediated events
NCI : PAR1-mediated thrombin signaling events
NCI : PAR4-mediated thrombin signaling events
NCI : Plasma membrane estrogen receptor signaling
NCI : S1P2 pathway
NCI : S1P3 pathway
NCI : Sphingosine 1-phosphate (S1P) pathway
NCI : Thromboxane A2 receptor signaling
Panther : Heterotrimeric G-protein signaling pathway-Gq alpha and Go alpha mediated pathway
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Metabotropic glutamate receptor group I pathway
Panther : Wnt signaling pathway
Reactome : ADP signalling through P2Y purinoceptor 1
Reactome : Acetylcholine regulates insulin secretion
Reactome : Fatty Acids bound to GPR40 (FFAR1) regulate insulin secretion
Reactome : Free fatty acids regulate insulin secretion
Reactome : G alpha (q) signalling events
Reactome : GPCR downstream signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : Integration of energy metabolism
Reactome : Metabolism
Reactome : Platelet activation, signaling and aggregation
Reactome : Regulation of insulin secretion
Reactome : Signal Transduction
Reactome : Signal amplification
Reactome : Signaling by GPCR
Reactome : Thrombin signalling through proteinase activated receptors (PARs)
Reactome : Thromboxane signalling through TP receptor
WikiPathway : G Protein Signaling Pathways

Protein

SMART domain : G_alpha : G protein alpha subunit
UniProt : E9KL47
UniProt : P30679
HPRD : 00760

Clone

Cloning Information : 110050
HIP Master Clone ID : 86333
Original Clone ID : FLH110050.01X

Organism


TAX_ID : 9606
Species Specific ID: 2769

Genome

Chromosome : 19
Map Location : 19p13.3
Ensembl : ENSG00000060558

Reagents

Labome : GNA15-antibody