DNASU Plasmid Repository • 480.965.5697 | Email

KRAS2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  KRAS
Gene Name:  Kirsten rat sarcoma viral oncogene homolog
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH015685.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
Yes / No
Publications: None
Authors: HIP
HsCD00002420

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 567nts         Open reading frame : 1 to 567
Reference Sequence Alignment

ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACG
ATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTAC
AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT
CATGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGT
GTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATT
AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTG
CCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT
TTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTT
CGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAG
TCAAAGACAAAGTGTGTAATTATGTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 726
Start on reference sequence 160
Mutations:
Mutation does not appear as "discrepancy" because it is present on the reference sequence

Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : KRAS
Symbol Nomenclature : KRAS
SYNONYM : C-K-RAS; CFC2; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS1; KRAS2; NS; NS3; RASK2
Designation : GTPase KRas|K-Ras 2|K-ras p21 protein|PR310 c-K-ras oncogene|c-Ki-ras|c-Kirsten-ras protein|cellular c-Ki-ras2 proto-oncogene|oncogene KRAS2|transforming protein p21|v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog|v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Full Nomenclature : Kirsten rat sarcoma viral oncogene homolog
GENEID : 3845
GI : 61370981
GenBank Accession : AY891660
HGNC : 6407
MIM : 190070
Vega : OTTHUMG00000171193
Target GenBank: BC013572

 

Reference Sequence Alignment

  

HsCD00002420      ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACG
NM_004985.4       ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACG
                  ************************************************************

HsCD00002420      ATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTAC
NM_004985.4       ATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTAC
                  ************************************************************

HsCD00002420      AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT
NM_004985.4       AGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGT
                  ************************************************************

HsCD00002420      CATGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGT
NM_004985.4       CAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGT
                  **:*********************************************************

HsCD00002420      GTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATT
NM_004985.4       GTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATT
                  ************************************************************

HsCD00002420      AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTG
NM_004985.4       AAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTG
                  ************************************************************

HsCD00002420      CCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT
NM_004985.4       CCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCT
                  ************************************************************

HsCD00002420      TTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTT
NM_004985.4       TTTATTGAAACATCAGCAAAGACAAGACAGGGTGTTGATGATGCCTTCTATACATTAGTT
                  ************************************************************

HsCD00002420      CGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAG
NM_004985.4       CGAGAAATTCGAAAACATAAAGAAAAGATGAGCAAAGATGGTAAAAAGAAGAAAAAGAAG
                  ************************************************************

HsCD00002420      TCAAAGACAAAGTGTGTAATTATGTTG
NM_004985.4       TCAAAGACAAAGTGTGTAATTATGTAA
                  *************************:.

Pathways

NCI : Regulation of Ras family activation
Panther : Inflammation mediated by chemokine and cytokine signaling pathway
Panther : Ras Pathway
Panther : p53 pathway feedback loops 2
Reactome : ARMS-mediated activation
Reactome : Activation of RAS in B cells
Reactome : Adaptive Immune System
Reactome : Axon guidance
Reactome : Cell surface interactions at the vascular wall
Reactome : Cytokine Signaling in Immune system
Reactome : DAP12 interactions
Reactome : DAP12 signaling
Reactome : Developmental Biology
Reactome : Disease
Reactome : Downstream signal transduction
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : Downstream signaling of activated FGFR
Reactome : EGFR Transactivation by Gastrin
Reactome : FCERI mediated MAPK activation
Reactome : FRS2-mediated cascade
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Frs2-mediated activation
Reactome : GRB2 events in EGFR signaling
Reactome : GRB2 events in ERBB2 signaling
Reactome : Gastrin-CREB signalling pathway via PKC and MAPK
Reactome : Hemostasis
Reactome : IGF1R signaling cascade
Reactome : IRS-mediated signalling
Reactome : IRS-related events
Reactome : IRS-related events triggered by IGF1R
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Interleukin-2 signaling
Reactome : MEK activation
Reactome : NCAM signaling for neurite out-growth
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Prolonged ERK activation events
Reactome : RAF activation
Reactome : RAF phosphorylates MEK
Reactome : RAF/MAP kinase cascade
Reactome : SHC-mediated cascade
Reactome : SHC-mediated signalling
Reactome : SHC-related events
Reactome : SHC-related events triggered by IGF1R
Reactome : SHC1 events in EGFR signaling
Reactome : SHC1 events in ERBB2 signaling
Reactome : SHC1 events in ERBB4 signaling
Reactome : SOS-mediated signalling
Reactome : Signal Transduction
Reactome : Signaling by EGFR
Reactome : Signaling by EGFR in Cancer
Reactome : Signaling by ERBB2
Reactome : Signaling by ERBB4
Reactome : Signaling by FGFR
Reactome : Signaling by FGFR in disease
Reactome : Signaling by FGFR mutants
Reactome : Signaling by GPCR
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by Leptin
Reactome : Signaling by PDGF
Reactome : Signaling by SCF-KIT
Reactome : Signaling by Type 1 Insulin-like Growth Factor 1 Receptor (IGF1R)
Reactome : Signaling by constitutively active EGFR
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : Signalling to RAS
Reactome : Signalling to p38 via RIT and RIN
Reactome : Tie2 Signaling
Reactome : p38MAPK events
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : Epithelium TarBase
WikiPathway : ErbB signaling pathway
WikiPathway : G Protein Signaling Pathways
WikiPathway : IL-5 signaling pathway
WikiPathway : Integrated Breast Cancer Pathway
WikiPathway : Lymphocyte TarBase
WikiPathway : MAPK Cascade
WikiPathway : MAPK signaling pathway
WikiPathway : Muscle cell TarBase
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : angiogenesis overview

Clone

Cloning Information : 15685
HIP Master Clone ID : 29884
Original Clone ID : FLH015685.01L

Organism


TAX_ID : 9606
Species Specific ID: 3845

Genome

Chromosome : 12
Map Location : 12p12.1
Ensembl : ENSG00000133703

Reagents

Labome : Ras-antibody