DNASU Plasmid Repository • 480.965.5697 | Email

PAPSS1 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PAPSS1
Gene Name:  3'-phosphoadenosine 5'-phosphosulfate synthase 1
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH000074.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 15928075
Title: Building a human kinase gene repository: bioinformatics, molecular cloning, and functional validation.
Authors: HIP
HsCD00002468

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1812nts         Open reading frame : 1 to 1812
Reference Sequence Alignment

ATGCAGAGAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGAGGT
CAGGTGGTGGGGACCAGAGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTGTCT
GGAGCGGGAAAGACTACTGTGAGCATGGCCTTGGAGGAGTACCTGGTTTGTCATGGTATT
CCATGCTACACTCTGGATGGTGACAATATTCGTCAAGGTCTCAATAAAAATCTTGGCTTT
AGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGCTAAACTGTTTGCA
GATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAACAAT
GCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCTCCT
CTGCATGTTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGAGAA
ATTAAAGGTTTCACTGGGATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTGGTG
CTGAAAACAGACTCCTGTGATGTAAATGACTGTGTCCAGCAAGTTGTGGAACTTCTACAG
GAACGGGATATTGTACCTGTGGATGCATCTTATGAAGTAAAAGAACTATATGTGCCAGAA
AATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACTGAAAATTAATAAA
GTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGCTTT
ATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGTGTC
ATTAACTTGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTGGAC
GGCTGTACAGCATTTGCTCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAATCCA
GAGTTTTTTGAGCACAGGAAAGAGGAGCGCTGTGCCAGACAGTGGGGAACGACATGCAAG
AACCACCCCTATATTAAGATGGTGATGGAACAAGGAGATTGGCTGATTGGAGGAGATCTT
CAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCGTCTTACTCCTACT
GAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTACGC
AACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTAGAG
AGGGGCTACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGATGAC
GATGTTCCTTTGATGTGGCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTTCTG
AATCCTGAGACGACAGTGGTGGCCATCTTCCCATCTCCCATGATGTATGCTGGACCAACT
GAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAGGAGCCAACTTTTACATTGTTGGA
CGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTATGAGCCAAGTCAT
GGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTTCGA
GTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCATGAA
GACTTTGAATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAACCA
CCTGAAGGTTTCATGGCTCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCCTTG
GAGAAAGCTTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1832
Start on reference sequence 21
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PAPSS1
Symbol Nomenclature : PAPSS1
SYNONYM : ATPSK1; PAPSS; SK1
Designation : 3-prime-phosphoadenosine 5-prime-phosphosulfate synthase 1|PAPS synthase 1|PAPSS 1|SK 1|bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1|sulfurylase kinase 1
Full Nomenclature : 3'-phosphoadenosine 5'-phosphosulfate synthase 1
GENEID : 9061
GI : 33303834
GenBank Accession : AY335604
HGNC : 8603
MIM : 603262
Vega : OTTHUMG00000131210
Target GenBank: BC011392

 

Reference Sequence Alignment

  

HsCD00002468      ------------------------------------------------------------
NM_005443.4       ATGGAGATCCCCGGGAGCCTGTGCAAGAAAGTCAAACTGAGCAATAACGCGCAGAACTGG
                                                                              

HsCD00002468      ---ATGCAGAGAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGA
NM_005443.4       GGAATGCAGAGAGCAACCAATGTCACCTACCAAGCCCATCATGTCAGCAGGAACAAGAGA
                     *********************************************************

HsCD00002468      GGTCAGGTGGTGGGGACCAGAGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTG
NM_005443.4       GGTCAGGTGGTGGGGACCAGAGGTGGCTTTCGTGGTTGCACAGTTTGGCTAACAGGCTTG
                  ************************************************************

HsCD00002468      TCTGGAGCGGGAAAGACTACTGTGAGCATGGCCTTGGAGGAGTACCTGGTTTGTCATGGT
NM_005443.4       TCTGGAGCGGGAAAGACTACTGTGAGCATGGCCTTGGAGGAGTACCTGGTTTGTCATGGT
                  ************************************************************

HsCD00002468      ATTCCATGCTACACTCTGGATGGTGACAATATTCGTCAAGGTCTCAATAAAAATCTTGGC
NM_005443.4       ATTCCATGCTACACTCTGGATGGTGACAATATTCGTCAAGGTCTCAATAAAAATCTTGGC
                  ************************************************************

HsCD00002468      TTTAGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGCTAAACTGTTT
NM_005443.4       TTTAGTCCTGAAGACAGAGAAGAGAATGTTCGACGCATCGCAGAAGTTGCTAAACTGTTT
                  ************************************************************

HsCD00002468      GCAGATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAAC
NM_005443.4       GCAGATGCTGGCTTAGTGTGCATCACAAGTTTCATATCACCTTACACTCAGGATCGCAAC
                  ************************************************************

HsCD00002468      AATGCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCT
NM_005443.4       AATGCAAGGCAAATTCATGAAGGTGCAAGTTTACCGTTTTTTGAAGTATTTGTTGATGCT
                  ************************************************************

HsCD00002468      CCTCTGCATGTTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGA
NM_005443.4       CCTCTGCATGTTTGTGAACAGAGGGATGTCAAAGGACTCTACAAAAAAGCCCGGGCAGGA
                  ************************************************************

HsCD00002468      GAAATTAAAGGTTTCACTGGGATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTG
NM_005443.4       GAAATTAAAGGTTTCACTGGGATCGATTCTGAATATGAAAAGCCAGAGGCCCCTGAGTTG
                  ************************************************************

HsCD00002468      GTGCTGAAAACAGACTCCTGTGATGTAAATGACTGTGTCCAGCAAGTTGTGGAACTTCTA
NM_005443.4       GTGCTGAAAACAGACTCCTGTGATGTAAATGACTGTGTCCAGCAAGTTGTGGAACTTCTA
                  ************************************************************

HsCD00002468      CAGGAACGGGATATTGTACCTGTGGATGCATCTTATGAAGTAAAAGAACTATATGTGCCA
NM_005443.4       CAGGAACGGGATATTGTACCTGTGGATGCATCTTATGAAGTAAAAGAACTATATGTGCCA
                  ************************************************************

HsCD00002468      GAAAATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACTGAAAATTAAT
NM_005443.4       GAAAATAAACTTCATTTGGCAAAAACAGATGCGGAAACATTACCAGCACTGAAAATTAAT
                  ************************************************************

HsCD00002468      AAAGTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGC
NM_005443.4       AAAGTGGATATGCAGTGGGTGCAGGTTTTGGCAGAAGGTTGGGCAACCCCATTGAATGGC
                  ************************************************************

HsCD00002468      TTTATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGT
NM_005443.4       TTTATGAGAGAGAGGGAGTACTTGCAGTGCCTTCATTTTGATTGTCTTCTGGATGGAGGT
                  ************************************************************

HsCD00002468      GTCATTAACTTGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTG
NM_005443.4       GTCATTAACTTGTCAGTACCTATAGTTCTGACTGCGACTCATGAAGATAAAGAGAGGCTG
                  ************************************************************

HsCD00002468      GACGGCTGTACAGCATTTGCTCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAAT
NM_005443.4       GACGGCTGTACAGCATTTGCTCTGATGTATGAGGGCCGCCGTGTGGCCATTCTTCGCAAT
                  ************************************************************

HsCD00002468      CCAGAGTTTTTTGAGCACAGGAAAGAGGAGCGCTGTGCCAGACAGTGGGGAACGACATGC
NM_005443.4       CCAGAGTTTTTTGAGCACAGGAAAGAGGAGCGCTGTGCCAGACAGTGGGGAACGACATGC
                  ************************************************************

HsCD00002468      AAGAACCACCCCTATATTAAGATGGTGATGGAACAAGGAGATTGGCTGATTGGAGGAGAT
NM_005443.4       AAGAACCACCCCTATATTAAGATGGTGATGGAACAAGGAGATTGGCTGATTGGAGGAGAT
                  ************************************************************

HsCD00002468      CTTCAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCGTCTTACTCCT
NM_005443.4       CTTCAAGTCTTGGATCGAGTTTATTGGAATGATGGTCTTGATCAGTATCGTCTTACTCCT
                  ************************************************************

HsCD00002468      ACTGAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTA
NM_005443.4       ACTGAGCTAAAGCAGAAATTTAAAGATATGAATGCTGATGCTGTCTTTGCATTTCAACTA
                  ************************************************************

HsCD00002468      CGCAACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTA
NM_005443.4       CGCAACCCAGTGCACAATGGACATGCCCTGTTAATGCAGGATACCCATAAGCAACTTCTA
                  ************************************************************

HsCD00002468      GAGAGGGGCTACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGAT
NM_005443.4       GAGAGGGGCTACCGGCGCCCTGTCCTCCTCCTCCACCCTCTGGGTGGCTGGACAAAGGAT
                  ************************************************************

HsCD00002468      GACGATGTTCCTTTGATGTGGCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTT
NM_005443.4       GACGATGTTCCTTTGATGTGGCGTATGAAGCAGCATGCTGCAGTGTTGGAGGAAGGAGTT
                  ************************************************************

HsCD00002468      CTGAATCCTGAGACGACAGTGGTGGCCATCTTCCCATCTCCCATGATGTATGCTGGACCA
NM_005443.4       CTGAATCCTGAGACGACAGTGGTGGCCATCTTCCCATCTCCCATGATGTATGCTGGACCA
                  ************************************************************

HsCD00002468      ACTGAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAGGAGCCAACTTTTACATTGTT
NM_005443.4       ACTGAGGTCCAGTGGCATTGCAGAGCACGGATGGTTGCAGGAGCCAACTTTTACATTGTT
                  ************************************************************

HsCD00002468      GGACGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTATGAGCCAAGT
NM_005443.4       GGACGAGACCCTGCTGGCATGCCTCATCCAGAAACAGGGAAGGATCTTTATGAGCCAAGT
                  ************************************************************

HsCD00002468      CATGGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTT
NM_005443.4       CATGGTGCCAAAGTGCTGACGATGGCCCCTGGTTTAATCACTTTGGAAATAGTTCCCTTT
                  ************************************************************

HsCD00002468      CGAGTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCAT
NM_005443.4       CGAGTTGCAGCTTACAACAAGAAAAAGAAGCGTATGGACTACTATGACTCTGAACACCAT
                  ************************************************************

HsCD00002468      GAAGACTTTGAATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAA
NM_005443.4       GAAGACTTTGAATTTATTTCAGGAACACGAATGCGCAAACTTGCTCGAGAAGGCCAGAAA
                  ************************************************************

HsCD00002468      CCACCTGAAGGTTTCATGGCTCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCC
NM_005443.4       CCACCTGAAGGTTTCATGGCTCCCAAGGCTTGGACCGTGCTGACAGAATACTACAAATCC
                  ************************************************************

HsCD00002468      TTGGAGAAAGCTTTG
NM_005443.4       TTGGAGAAAGCTTAG
                  *************:*

Pathways

Panther : Sulfate assimilation
Reactome : Biological oxidations
Reactome : Cytosolic sulfonation of small molecules
Reactome : Disease
Reactome : Glycogen storage diseases
Reactome : Glycosaminoglycan metabolism
Reactome : MPS I - Hurler syndrome
Reactome : MPS II - Hunter syndrome
Reactome : MPS IIIA - Sanfilippo syndrome A
Reactome : MPS IIIB - Sanfilippo syndrome B
Reactome : MPS IIIC - Sanfilippo syndrome C
Reactome : MPS IIID - Sanfilippo syndrome D
Reactome : MPS IV - Morquio syndrome A
Reactome : MPS IV - Morquio syndrome B
Reactome : MPS IX - Natowicz syndrome
Reactome : MPS VI - Maroteaux-Lamy syndrome
Reactome : MPS VII - Sly syndrome
Reactome : Metabolism
Reactome : Metabolism of carbohydrates
Reactome : Mucopolysaccharidoses
Reactome : Myoclonic epilepsy of Lafora
Reactome : Phase II conjugation
Reactome : Transport and synthesis of PAPS
WikiPathway : Sulfation Biotransformation Reaction

Protein

UniProt : Q6IAX6
UniProt : O43252
HPRD : 09132

Clone

Cloning Information : 74
HIP Master Clone ID : 87273
Original Clone ID : FLH000074.01L

Organism


TAX_ID : 9606
Species Specific ID: 9061

Genome

Chromosome : 4
Map Location : 4q24
Ensembl : ENSG00000138801

Reagents

Labome : PAPSS1-antibody