DNASU Plasmid Repository • 480.965.5697 | Email

NFKBIA (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NFKBIA
Gene Name:  nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH130088.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000255

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 954nts         Open reading frame : 1 to 954
Reference Sequence Alignment

ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTG
AAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAG
GAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCG
CGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTG
GCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAGGGAGAC
CTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCACTCCACTTGGCTGTGATC
ACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGA
GACTTTCGAGGAAATACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTG
GGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAAC
TACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAG
CTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCC
CTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGG
GCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGC
CCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTG
CCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAG
GACGAGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTAGAC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1048
Start on reference sequence 95
Mutations:
None
Discrepancy:
t306c
                                

5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NFKBIA
Symbol Nomenclature : NFKBIA
SYNONYM : IKBA; MAD-3; NFKBI
Designation : I-kappa-B-alpha|IkappaBalpha|NF-kappa-B inhibitor alpha|ikB-alpha|major histocompatibility complex enhancer-binding protein MAD3|nuclear factor of kappa light chain gene enhancer in B-cells
Full Nomenclature : nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha
GENEID : 4792
GI : 60825836
GenBank Accession : AY893698
HGNC : 7797
MIM : 164008
Vega : OTTHUMG00000140220
Target GenBank: NM_020529

 

Reference Sequence Alignment

  

HsCD00000255      ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTG
NM_020529.2       ATGTTCCAGGCGGCCGAGCGCCCCCAGGAGTGGGCCATGGAGGGCCCCCGCGACGGGCTG
                  ************************************************************

HsCD00000255      AAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAG
NM_020529.2       AAGAAGGAGCGGCTACTGGACGACCGCCACGACAGCGGCCTGGACTCCATGAAAGACGAG
                  ************************************************************

HsCD00000255      GAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCG
NM_020529.2       GAGTACGAGCAGATGGTCAAGGAGCTGCAGGAGATCCGCCTCGAGCCGCAGGAGGTGCCG
                  ************************************************************

HsCD00000255      CGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTG
NM_020529.2       CGCGGCTCGGAGCCCTGGAAGCAGCAGCTCACCGAGGACGGGGACTCGTTCCTGCACTTG
                  ************************************************************

HsCD00000255      GCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAGGGAGAC
NM_020529.2       GCCATCATCCATGAAGAAAAGGCACTGACCATGGAAGTGATCCGCCAGGTGAAGGGAGAC
                  ************************************************************

HsCD00000255      CTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCACTCCACTTGGCTGTGATC
NM_020529.2       CTGGCCTTCCTCAACTTCCAGAACAACCTGCAGCAGACTCCACTCCACTTGGCTGTGATC
                  ************************************************************

HsCD00000255      ACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGA
NM_020529.2       ACCAACCAGCCAGAAATTGCTGAGGCACTTCTGGGAGCTGGCTGTGATCCTGAGCTCCGA
                  ************************************************************

HsCD00000255      GACTTTCGAGGAAATACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTG
NM_020529.2       GACTTTCGAGGAAATACCCCCCTACACCTTGCCTGTGAGCAGGGCTGCCTGGCCAGCGTG
                  ************************************************************

HsCD00000255      GGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAAC
NM_020529.2       GGAGTCCTGACTCAGTCCTGCACCACCCCGCACCTCCACTCCATCCTGAAGGCTACCAAC
                  ************************************************************

HsCD00000255      TACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAG
NM_020529.2       TACAATGGCCACACGTGTCTACACTTAGCCTCTATCCATGGCTACCTGGGCATCGTGGAG
                  ************************************************************

HsCD00000255      CTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCC
NM_020529.2       CTTTTGGTGTCCTTGGGTGCTGATGTCAATGCTCAGGAGCCCTGTAATGGCCGGACTGCC
                  ************************************************************

HsCD00000255      CTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGG
NM_020529.2       CTTCACCTCGCAGTGGACCTGCAAAATCCTGACCTGGTGTCACTCCTGTTGAAGTGTGGG
                  ************************************************************

HsCD00000255      GCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGC
NM_020529.2       GCTGATGTCAACAGAGTTACCTACCAGGGCTATTCTCCCTACCAGCTCACCTGGGGCCGC
                  ************************************************************

HsCD00000255      CCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTG
NM_020529.2       CCAAGCACCCGGATACAGCAGCAGCTGGGCCAGCTGACACTAGAAAACCTTCAGATGCTG
                  ************************************************************

HsCD00000255      CCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAG
NM_020529.2       CCAGAGAGTGAGGATGAGGAGAGCTATGACACAGAGTCAGAGTTCACGGAGTTCACAGAG
                  ************************************************************

HsCD00000255      GACGAGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTAGAC
NM_020529.2       GACGAGCTGCCCTATGATGACTGTGTGTTTGGAGGCCAGCGTCTGACGTTATGA
                  *************************************************** ..

Pathways

NCI : Atypical NF-kappaB pathway
NCI : Aurora A signaling
NCI : BCR signaling pathway
NCI : CD40/CD40L signaling
NCI : Canonical NF-kappaB pathway
NCI : Ceramide signaling pathway
NCI : HIV-1 Nef: Negative effector of Fas and TNF-alpha
NCI : IL23-mediated signaling events
NCI : LPA receptor mediated events
NCI : Osteopontin-mediated events
NCI : Signaling events mediated by HDAC Class I
Panther : Apoptosis signaling pathway
Panther : B cell activation
Panther : T cell activation
Panther : Toll receptor signaling pathway
Reactome : Activated TLR4 signalling
Reactome : Activation of NF-kappaB in B cells
Reactome : Adaptive Immune System
Reactome : Cytosolic sensors of pathogen-associated DNA
Reactome : Downstream TCR signaling
Reactome : Downstream signaling events of B Cell Receptor (BCR)
Reactome : FCERI mediated NF-kB activation
Reactome : Fc epsilon receptor (FCERI) signaling
Reactome : Immune System
Reactome : Innate Immune System
Reactome : MyD88 cascade initiated on plasma membrane
Reactome : MyD88 dependent cascade initiated on endosome
Reactome : MyD88-independent cascade
Reactome : MyD88:Mal cascade initiated on plasma membrane
Reactome : NF-kB is activated and signals survival
Reactome : RIG-I/MDA5 mediated induction of IFN-alpha/beta pathways
Reactome : RIP-mediated NFkB activation via ZBP1
Reactome : Signal Transduction
Reactome : Signaling by the B Cell Receptor (BCR)
Reactome : Signalling by NGF
Reactome : TAK1 activates NFkB by phosphorylation and activation of IKKs complex
Reactome : TCR signaling
Reactome : TRAF6 Mediated Induction of proinflammatory cytokines
Reactome : TRAF6 mediated NF-kB activation
Reactome : TRAF6 mediated induction of NFkB and MAP kinases upon TLR7/8 or 9 activation
Reactome : TRIF-mediated TLR3/TLR4 signaling
Reactome : Toll Like Receptor 10 (TLR10) Cascade
Reactome : Toll Like Receptor 2 (TLR2) Cascade
Reactome : Toll Like Receptor 3 (TLR3) Cascade
Reactome : Toll Like Receptor 4 (TLR4) Cascade
Reactome : Toll Like Receptor 5 (TLR5) Cascade
Reactome : Toll Like Receptor 7/8 (TLR7/8) Cascade
Reactome : Toll Like Receptor 9 (TLR9) Cascade
Reactome : Toll Like Receptor TLR1:TLR2 Cascade
Reactome : Toll Like Receptor TLR6:TLR2 Cascade
Reactome : Toll-Like Receptors Cascades
Reactome : ZBP1(DAI) mediated induction of type I IFNs
Reactome : p75 NTR receptor-mediated signalling
Reactome : p75NTR signals via NF-kB
WikiPathway : Apoptosis
WikiPathway : Apoptosis Modulation and Signaling
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : IL-1 signaling pathway
WikiPathway : IL-4 signaling pathway
WikiPathway : NOD pathway
WikiPathway : Prolactin Signaling Pathway
WikiPathway : RANKL/RANK Signaling Pathway
WikiPathway : Regulation of toll-like receptor signaling pathway
WikiPathway : TCR Signaling Pathway
WikiPathway : TNF alpha Signaling Pathway
WikiPathway : TWEAK Signaling Pathway
WikiPathway : Toll-like receptor signaling pathway

Protein

SMART domain : ANK : ankyrin repeats
UniProt : P25963
HPRD : 01235

Clone

Cloning Information : 130088
HIP Master Clone ID : 106237
Original Clone ID : FLH130088.01L

Organism


TAX_ID : 9606
Species Specific ID: 4792

Genome

Chromosome : 14
Map Location : 14q13
Ensembl : ENSG00000100906

Reagents

Labome : IkappaBalpha-antibody