DNASU Plasmid Repository • 480.965.5697 | Email

NCBP2 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NCBP2
Gene Name:  nuclear cap binding protein subunit 2, 20kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH026020.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00002576

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 471nts         Open reading frame : 1 to 471
Reference Sequence Alignment

ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGT
ACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTC
AGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCA
TGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTAC
ATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAG
GAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAG
GACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 497
Start on reference sequence 27
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NCBP2
Symbol Nomenclature : NCBP2
SYNONYM : CBC2; CBP20; NIP1
Designation : 20 kDa nuclear cap-binding protein|NCBP 20 kDa subunit|NCBP interacting protein 1|NCBP-interacting protein 1|cell proliferation-inducing gene 55 protein|nuclear cap-binding protein subunit 2
Full Nomenclature : nuclear cap binding protein subunit 2, 20kDa
GENEID : 22916
Locus Tag : PIG55
GI : 60654826
GenBank Accession : AY889187
HGNC : 7659
MIM : 605133
Vega : OTTHUMG00000155520
Target GenBank: BC001255

 

Reference Sequence Alignment

  

HsCD00002576      ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
NM_007362.3       ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTAC
                  ************************************************************

HsCD00002576      CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGT
NM_007362.3       CGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGT
                  ************************************************************

HsCD00002576      ACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTC
NM_007362.3       ACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTC
                  ************************************************************

HsCD00002576      AGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCA
NM_007362.3       AGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCA
                  ************************************************************

HsCD00002576      TGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTAC
NM_007362.3       TGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTAC
                  ************************************************************

HsCD00002576      ATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAG
NM_007362.3       ATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAG
                  ************************************************************

HsCD00002576      GAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAG
NM_007362.3       GAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAG
                  ************************************************************

HsCD00002576      GACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTAG
NM_007362.3       GACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTGA
                  *************************************************..

Pathways

Reactome : Abortive elongation of HIV-1 transcript in the absence of Tat
Reactome : Cleavage of Growing Transcript in the Termination Region
Reactome : Disease
Reactome : Formation of HIV elongation complex in the absence of HIV Tat
Reactome : Formation of HIV-1 elongation complex containing HIV-1 Tat
Reactome : Formation of RNA Pol II elongation complex
Reactome : Formation of the Early Elongation Complex
Reactome : Formation of the HIV-1 Early Elongation Complex
Reactome : Gene Expression
Reactome : HIV Infection
Reactome : HIV Life Cycle
Reactome : HIV Transcription Elongation
Reactome : Late Phase of HIV Life Cycle
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of non-coding RNA
Reactome : Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
Reactome : Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)
Reactome : Nonsense-Mediated Decay (NMD)
Reactome : Post-Elongation Processing of Intron-Containing pre-mRNA
Reactome : Post-Elongation Processing of Intronless pre-mRNA
Reactome : Post-Elongation Processing of the Transcript
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Processing of Capped Intronless Pre-mRNA
Reactome : Processing of Intronless Pre-mRNAs
Reactome : RNA Polymerase II Pre-transcription Events
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Elongation
Reactome : RNA Polymerase II Transcription Termination
Reactome : SLBP Dependent Processing of Replication-Dependent Histone Pre-mRNAs
Reactome : SLBP independent Processing of Histone Pre-mRNAs
Reactome : Tat-mediated elongation of the HIV-1 transcript
Reactome : Transcription
Reactome : Transcription of the HIV genome
Reactome : Transport of Mature Transcript to Cytoplasm
Reactome : Transport of Mature mRNA Derived from an Intronless Transcript
Reactome : Transport of Mature mRNA derived from an Intron-Containing Transcript
Reactome : Transport of Mature mRNAs Derived from Intronless Transcripts
Reactome : Transport of the SLBP Dependant Mature mRNA
Reactome : Transport of the SLBP independent Mature mRNA
Reactome : mRNA 3'-end processing
Reactome : mRNA Capping
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
Reactome : mRNA Splicing - Minor Pathway
Reactome : snRNP Assembly
WikiPathway : mRNA processing

Protein

SMART domain : RRM : RNA recognition motif
UniProt : E9PAR5
UniProt : P52298
HPRD : 05503

Clone

Cloning Information : 26020
HIP Master Clone ID : 56396
Original Clone ID : FLH026020.01X

Organism


TAX_ID : 9606
Species Specific ID: 22916

Genome

Chromosome : 3
Map Location : 3q29
Ensembl : ENSG00000114503

Reagents

Labome : NCBP2-antibody