DNASU Plasmid Repository • 480.965.5697 | Email

RPL34 (Homo sapiens) in pDONR201 (Gateway donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RPL34
Gene Name:  ribosomal protein L34
Sequence              Map: pDONR cofig.pdf
Original Clone ID: FLH058552.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR201               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: HIP
HsCD00000259

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 354nts         Open reading frame : 1 to 354

ATGGTCCAGCGTTTGACATACCGACGTAGGCTTTCCTACAATACAGCCTCTAACAAAACT
AGGCTGTCCCGAACCCCTGGTAATAGAATTGTTTACCTTTATACCAAGAAGGTTGGGAAA
GCACCAAAATCTGCATGTGGTGTGTGCCCAGGCAGACTTCGAGGGGTTCGTGCTGTAAGA
CCTAAAGTTCTTATGAGATTGTCCAAAACAAAGAAACATGTCAGCAGGGCCTATGGTGGT
TCCATGTGTGCTAAATGTGTTCGTGACAGGATCAAGCGTGCTTTCCTTATCGAGGAGCAG
AAAATCGTTGTGAAAGTGTTGAAGGCACAAGCACAGAGTCAGAAAGCTAAATAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 420
Start on reference sequence 67
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
GTACAAAAAAGCAGGCTCCACC(atg-goi)

3' Linker Sequence:
(goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDONR201

pDONR201 in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  pDONR201-forward
Reverse:  pDONR201-reverse
Description: Recombinational donor/master vector; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4470
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE ColE1 (pUC-type) origin of replication (modified, low copy number) 3744 4426
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1264 959
primer site forward primer recommended forward primer site 5 tcgcgttaacgctagcatggatctc 3 300 324
primer site reverse primer recommended reverse primer site 5 gtaacatcagagattttgagacac 3 2769 2792
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2744 2513
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 332 563
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2744 2513
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 332 563
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2265 2513
selectable marker KanR kanamycin resistance gene 2868 3677
trxn termination sequence rrn T2 rrn T2 transcription termination sequence 73 100
trxn termination sequence rrn T1 rrn T1 transcription termination sequence 232 275

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RPL34
Symbol Nomenclature : RPL34
SYNONYM : L34
Designation : 60S ribosomal protein L34|leukemia-associated protein
Full Nomenclature : ribosomal protein L34
GENEID : 6164
GI : 60814024
GenBank Accession : AY893247
HGNC : 10340
Vega : OTTHUMG00000131839
Target GenBank: BC001773

 

Pathways

Reactome : 3' -UTR-mediated translational regulation
Reactome : Cap-dependent Translation Initiation
Reactome : Disease
Reactome : Eukaryotic Translation Elongation
Reactome : Eukaryotic Translation Initiation
Reactome : Eukaryotic Translation Termination
Reactome : Formation of a pool of free 40S subunits
Reactome : GTP hydrolysis and joining of the 60S ribosomal subunit
Reactome : Gene Expression
Reactome : Influenza Infection
Reactome : Influenza Life Cycle
Reactome : Influenza Viral RNA Transcription and Replication
Reactome : L13a-mediated translational silencing of Ceruloplasmin expression
Reactome : Metabolism of RNA
Reactome : Metabolism of mRNA
Reactome : Metabolism of proteins
Reactome : Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC)
Reactome : Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC)
Reactome : Nonsense-Mediated Decay (NMD)
Reactome : Peptide chain elongation
Reactome : SRP-dependent cotranslational protein targeting to membrane
Reactome : Translation
Reactome : Viral mRNA Translation
WikiPathway : Cytoplasmic Ribosomal Proteins

Protein

UniProt : P49207
HPRD : 17996

Clone

Cloning Information : 58552
HIP Master Clone ID : 39112
Original Clone ID : FLH058552.01X

Organism


TAX_ID : 9606
Species Specific ID: 6164

Genome

Chromosome : 4
Map Location : 4q25
Ensembl : ENSG00000109475

Reagents

Labome : RPL34-antibody