DNASU Plasmid Repository • 480.965.5697 | Email

CRK (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  CRK
Gene Name:  v-crk avian sarcoma virus CT10 oncogene homolog
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH012672.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00002591

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 915nts         Open reading frame : 1 to 915
Reference Sequence Alignment

ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGCGGTTGAGTCGG
CAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
AGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTAC
ATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCC
GGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTA
CTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGA
TCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGA
ATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGG
ATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCC
AGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
GAGGACTTCAGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1048
Start on reference sequence 134
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : CRK
Symbol Nomenclature : CRK
SYNONYM : CRKII; p38
Designation : adapter molecule crk|proto-oncogene c-Crk
Full Nomenclature : v-crk avian sarcoma virus CT10 oncogene homolog
GENEID : 1398
GI : 60654842
GenBank Accession : AY889195
HGNC : 2362
MIM : 164762
Vega : OTTHUMG00000090317
Target GenBank: BC008506

 

Reference Sequence Alignment

  

HsCD00002591      ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGCGGTTGAGTCGG
NM_016823.3       ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGG
                  ************************************************.***********

HsCD00002591      CAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
NM_016823.3       CAGGAGGCGGTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCG
                  ************************************************************

HsCD00002591      AGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTAC
NM_016823.3       AGCACCAGCCCCGGGGACTATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTAC
                  ************************************************************

HsCD00002591      ATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCC
NM_016823.3       ATCATCAACAGCAGCGGCCCGCGCCCGCCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCC
                  ************************************************************

HsCD00002591      GGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTA
NM_016823.3       GGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAAGAGTTTGATTCATTGCCTGCTTTA
                  ************************************************************

HsCD00002591      CTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGA
NM_016823.3       CTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATAGAACCAGTTTCCAGA
                  ************************************************************

HsCD00002591      TCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
NM_016823.3       TCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGAGCCCTC
                  ************************************************************

HsCD00002591      TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGA
NM_016823.3       TTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGA
                  ************************************************************

HsCD00002591      ATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGG
NM_016823.3       ATCCGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGG
                  ************************************************************

HsCD00002591      ATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
NM_016823.3       ATGATTCCAGTCCCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTG
                  ************************************************************

HsCD00002591      ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
NM_016823.3       ATTGGAGGTAACCAGGAGGGTTCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCC
                  ************************************************************

HsCD00002591      TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCC
NM_016823.3       TATGCCCAACCCAGCGTCAACACTCCGCTCCCTAACCTCCAGAATGGGCCCATATATGCC
                  ************************************************************

HsCD00002591      AGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
NM_016823.3       AGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAGACAGCCTTGGCTTTGGAGGTC
                  ************************************************************

HsCD00002591      GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
NM_016823.3       GGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAAGGGGAGTGTAAT
                  ************************************************************

HsCD00002591      GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
NM_016823.3       GGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCCGAT
                  ************************************************************

HsCD00002591      GAGGACTTCAGCTAG
NM_016823.3       GAGGACTTCAGCTGA
                  *************..

Pathways

NCI : Alpha4 beta1 integrin signaling events
NCI : Angiopoietin receptor Tie2-mediated signaling
NCI : CXCR4-mediated signaling events
NCI : E-cadherin signaling in the nascent adherens junction
NCI : EPHA forward signaling
NCI : Endothelins
NCI : IGF1 pathway
NCI : JNK signaling in the CD4+ TCR pathway
NCI : LPA receptor mediated events
NCI : Nectin adhesion pathway
NCI : Neurotrophic factor-mediated Trk receptor signaling
NCI : PDGFR-alpha signaling pathway
NCI : PDGFR-beta signaling pathway
NCI : RAC1 signaling pathway
NCI : Signaling events mediated by Hepatocyte Growth Factor Receptor (c-Met)
NCI : Signaling events mediated by PTP1B
NCI : Signaling events mediated by focal adhesion kinase
NCI : Signaling events regulated by Ret tyrosine kinase
NCI : Urokinase-type plasminogen activator (uPA) and uPAR-mediated signaling
NCI : VEGFR3 signaling in lymphatic endothelium
Panther : Angiogenesis
Panther : Integrin signalling pathway
Reactome : ARMS-mediated activation
Reactome : Cytokine Signaling in Immune system
Reactome : Downstream signal transduction
Reactome : Fcgamma receptor (FCGR) dependent phagocytosis
Reactome : Hemostasis
Reactome : Immune System
Reactome : Innate Immune System
Reactome : Insulin receptor signalling cascade
Reactome : Integrin alphaIIb beta3 signaling
Reactome : Interleukin-3, 5 and GM-CSF signaling
Reactome : NGF signalling via TRKA from the plasma membrane
Reactome : Platelet Aggregation (Plug Formation)
Reactome : Platelet activation, signaling and aggregation
Reactome : Prolonged ERK activation events
Reactome : Regulation of actin dynamics for phagocytic cup formation
Reactome : Regulation of signaling by CBL
Reactome : Signal Transduction
Reactome : Signal attenuation
Reactome : Signaling by Insulin receptor
Reactome : Signaling by Interleukins
Reactome : Signaling by PDGF
Reactome : Signalling by NGF
Reactome : Signalling to ERKs
Reactome : p130Cas linkage to MAPK signaling for integrins
WikiPathway : B Cell Receptor Signaling Pathway
WikiPathway : EGF/EGFR Signaling Pathway
WikiPathway : ErbB signaling pathway
WikiPathway : Focal Adhesion
WikiPathway : Insulin Signaling
WikiPathway : Integrin-mediated cell adhesion
WikiPathway : Kit receptor signaling pathway
WikiPathway : MAPK signaling pathway
WikiPathway : Regulation of Actin Cytoskeleton
WikiPathway : Signaling of Hepatocyte Growth Factor Receptor
WikiPathway : TCR Signaling Pathway
WikiPathway : angiogenesis overview

Protein

SMART domain : SH2 : Src homology 2 domains
SMART domain : SH3 : Src homology 3 domains
UniProt : P46108
HPRD : 01267

Clone

Cloning Information : 12672
HIP Master Clone ID : 26871
Original Clone ID : FLH012672.01X

Organism


TAX_ID : 9606
Species Specific ID: 1398

Genome

Chromosome : 17
Map Location : 17p13.3
Ensembl : ENSG00000167193

Reagents

Labome : Crk-antibody