DNASU Plasmid Repository • 480.965.5697 | Email

STHM (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  ST6GALNAC2
Gene Name:  ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH019136.01X
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  CLOSED
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / Yes
Publications: None
Authors: HIP
HsCD00000260

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1125nts         Open reading frame : 1 to 1125
Reference Sequence Alignment

ATGGGGCTCCCGCGCGGGTCGTTCTTCTGGCTGCTGCTCCTGCTCACGGCTGCCTGCTCG
GGGCTCCTCTTTGCCCTGTACTTCTCGGCGGTGCAGCGGTACCCGGGGCCAGCGGCCGGA
GCCAGGGACACCACATCATTTGAAGCATTCTTTCAATCCAAGGCATCGAATTCTTGGACA
GGAAAGGGCCAGGCCTGCCGACACCTGCTTCACCTGGCCATTCAGCGGCACCCCCGCTTC
CGTGGCCTGTTCAATCTCTCCATTCCAGTGCTGCTGTGGGGGGACCTCTTCACCCCAGCG
CTCTGGGACCGCCTGAGCCAACACAAAGCCCCGTATGGCTGGCGGGGGCTCTCTCACCAA
GTCATCGCCTCCACCCTGAGCCTTCTGAACGGCTCAGAGAGTGCCAAGCTGTTTGCCCCG
CCCAGGGACACCCCTCCAAAGTGTATCCGGTGTGCCGTGGTGGGCAACGGAGGCATTCTG
AATGGGTCCCGCCAGGGTCCCAACATCGATGCCCATGACTATGTATTCAGACTCAATGGA
GCTGTGATCAAAGGCTTCGAGCGCGATGTGGGCACCAAGACTTCCTTCTATGGTTTCACT
GTGAATACGATGAAGAACTCCCTCGTCTCCTACTGGAATCTGGGCTTCACCTCCGTGCCA
CAAGGACAGGACCTGCAGTATATCTTCATCCCCTCAGACATCCGCGACTATGTGATGCTG
AGATCGGCCATTCTGGGCGTGCCTGTCCCTGAGGGCCTAGATAAAGGGGACAGGCCGCAC
GCCTATTTTGGACCAGAAGCCTCTGCCAGTAAATTCAAGCTGCTACATCCGGACTTCATC
AGCTACCTGACAGAAAGGTTCTTGAAATCAAAGTTGATTAACACACATTTTGGAGACCTA
TATATGCCTAGTACCGGGGCTCTCATGCTGCTGACAGCTTTGCATACCTGTGACCAGGTC
AGTGCCTATGGATTCATCACAAGCAACTACTGGAAATTTTCCGACCACTATTTCGAACGA
AAAATGAAGCCATTGATATTTTATGCAAACCACGATCTGTCCCTGGAAGCTGCCCTGTGG
AGGGACCTGCACAAGGCCGGCATCCTTCAGCTGTACCAGCGCTAG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1164
Start on reference sequence 40
Mutations:
None
Discrepancy:
a236g,H79R; c606t
                                

5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : ST6GALNAC2
Symbol Nomenclature : ST6GALNAC2
SYNONYM : SAITL1; SIAT7; SIAT7B; SIATL1; ST6GalNAII; STHM
Designation : (alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide B|(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase|SIAT7-B|ST6GalNAc II|ST6GalNAcII|alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2|galNAc alpha-2,6-sialyltransferase II|sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide B|sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) B|sialyltransferase 7B|sialyltransferase-like 1
Full Nomenclature : ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
GENEID : 10610
GI : 61355245
GenBank Accession : AY888172
HGNC : 10867
MIM : 610137
Vega : OTTHUMG00000180301
Target GenBank: AJ251053

 

Reference Sequence Alignment

  

HsCD00000260      ATGGGGCTCCCGCGCGGGTCGTTCTTCTGGCTGCTGCTCCTGCTCACGGCTGCCTGCTCG
NM_006456.2       ATGGGGCTCCCGCGCGGGTCGTTCTTCTGGCTGCTGCTCCTGCTCACGGCTGCCTGCTCG
                  ************************************************************

HsCD00000260      GGGCTCCTCTTTGCCCTGTACTTCTCGGCGGTGCAGCGGTACCCGGGGCCAGCGGCCGGA
NM_006456.2       GGGCTCCTCTTTGCCCTGTACTTCTCGGCGGTGCAGCGGTACCCGGGGCCAGCGGCCGGA
                  ************************************************************

HsCD00000260      GCCAGGGACACCACATCATTTGAAGCATTCTTTCAATCCAAGGCATCGAATTCTTGGACA
NM_006456.2       GCCAGGGACACCACATCATTTGAAGCATTCTTTCAATCCAAGGCATCGAATTCTTGGACA
                  ************************************************************

HsCD00000260      GGAAAGGGCCAGGCCTGCCGACACCTGCTTCACCTGGCCATTCAGCGGCACCCCCGCTTC
NM_006456.2       GGAAAGGGCCAGGCCTGCCGACACCTGCTTCACCTGGCCATTCAGCGGCACCCCCACTTC
                  *******************************************************.****

HsCD00000260      CGTGGCCTGTTCAATCTCTCCATTCCAGTGCTGCTGTGGGGGGACCTCTTCACCCCAGCG
NM_006456.2       CGTGGCCTGTTCAATCTCTCCATTCCAGTGCTGCTGTGGGGGGACCTCTTCACCCCAGCG
                  ************************************************************

HsCD00000260      CTCTGGGACCGCCTGAGCCAACACAAAGCCCCGTATGGCTGGCGGGGGCTCTCTCACCAA
NM_006456.2       CTCTGGGACCGCCTGAGCCAACACAAAGCCCCGTATGGCTGGCGGGGGCTCTCTCACCAA
                  ************************************************************

HsCD00000260      GTCATCGCCTCCACCCTGAGCCTTCTGAACGGCTCAGAGAGTGCCAAGCTGTTTGCCCCG
NM_006456.2       GTCATCGCCTCCACCCTGAGCCTTCTGAACGGCTCAGAGAGTGCCAAGCTGTTTGCCCCG
                  ************************************************************

HsCD00000260      CCCAGGGACACCCCTCCAAAGTGTATCCGGTGTGCCGTGGTGGGCAACGGAGGCATTCTG
NM_006456.2       CCCAGGGACACCCCTCCAAAGTGTATCCGGTGTGCCGTGGTGGGCAACGGAGGCATTCTG
                  ************************************************************

HsCD00000260      AATGGGTCCCGCCAGGGTCCCAACATCGATGCCCATGACTATGTATTCAGACTCAATGGA
NM_006456.2       AATGGGTCCCGCCAGGGTCCCAACATCGATGCCCATGACTATGTATTCAGACTCAATGGA
                  ************************************************************

HsCD00000260      GCTGTGATCAAAGGCTTCGAGCGCGATGTGGGCACCAAGACTTCCTTCTATGGTTTCACT
NM_006456.2       GCTGTGATCAAAGGCTTCGAGCGCGATGTGGGCACCAAGACTTCCTTCTATGGTTTCACT
                  ************************************************************

HsCD00000260      GTGAATACGATGAAGAACTCCCTCGTCTCCTACTGGAATCTGGGCTTCACCTCCGTGCCA
NM_006456.2       GTGAACACGATGAAGAACTCCCTCGTCTCCTACTGGAATCTGGGCTTCACCTCCGTGCCA
                  ***** ******************************************************

HsCD00000260      CAAGGACAGGACCTGCAGTATATCTTCATCCCCTCAGACATCCGCGACTATGTGATGCTG
NM_006456.2       CAAGGACAGGACCTGCAGTATATCTTCATCCCCTCAGACATCCGCGACTATGTGATGCTG
                  ************************************************************

HsCD00000260      AGATCGGCCATTCTGGGCGTGCCTGTCCCTGAGGGCCTAGATAAAGGGGACAGGCCGCAC
NM_006456.2       AGATCGGCCATTCTGGGCGTGCCTGTCCCTGAGGGCCTAGATAAAGGGGACAGGCCGCAC
                  ************************************************************

HsCD00000260      GCCTATTTTGGACCAGAAGCCTCTGCCAGTAAATTCAAGCTGCTACATCCGGACTTCATC
NM_006456.2       GCCTATTTTGGACCAGAAGCCTCTGCCAGTAAATTCAAGCTGCTACATCCGGACTTCATC
                  ************************************************************

HsCD00000260      AGCTACCTGACAGAAAGGTTCTTGAAATCAAAGTTGATTAACACACATTTTGGAGACCTA
NM_006456.2       AGCTACCTGACAGAAAGGTTCTTGAAATCAAAGTTGATTAACACACATTTTGGAGACCTA
                  ************************************************************

HsCD00000260      TATATGCCTAGTACCGGGGCTCTCATGCTGCTGACAGCTTTGCATACCTGTGACCAGGTC
NM_006456.2       TATATGCCTAGTACCGGGGCTCTCATGCTGCTGACAGCTTTGCATACCTGTGACCAGGTC
                  ************************************************************

HsCD00000260      AGTGCCTATGGATTCATCACAAGCAACTACTGGAAATTTTCCGACCACTATTTCGAACGA
NM_006456.2       AGTGCCTATGGATTCATCACAAGCAACTACTGGAAATTTTCCGACCACTATTTCGAACGA
                  ************************************************************

HsCD00000260      AAAATGAAGCCATTGATATTTTATGCAAACCACGATCTGTCCCTGGAAGCTGCCCTGTGG
NM_006456.2       AAAATGAAGCCATTGATATTTTATGCAAACCACGATCTGTCCCTGGAAGCTGCCCTGTGG
                  ************************************************************

HsCD00000260      AGGGACCTGCACAAGGCCGGCATCCTTCAGCTGTACCAGCGCTAG
NM_006456.2       AGGGACCTGCACAAGGCCGGCATCCTTCAGCTGTACCAGCGCTGA
                  *******************************************..

Pathways

Reactome : Asparagine N-linked glycosylation
Reactome : Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein
Reactome : Metabolism of proteins
Reactome : O-linked glycosylation
Reactome : O-linked glycosylation of mucins
Reactome : Post-translational protein modification
Reactome : Sialic acid metabolism
Reactome : Synthesis of substrates in N-glycan biosythesis
Reactome : Termination of O-glycan biosynthesis

Protein

UniProt : Q9UJ37
HPRD : 10231

Clone

Cloning Information : 19136
HIP Master Clone ID : 33335
Original Clone ID : FLH019136.01X

Organism


TAX_ID : 9606
Species Specific ID: 10610

Genome

Chromosome : 17
Map Location : 17q25.1
Ensembl : ENSG00000070731

Reagents

Labome : ST6GALNAC2-antibody