DNASU Plasmid Repository • 480.965.5697 | Email

RFC3 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  RFC3
Gene Name:  replication factor C (activator 1) 3, 38kDa
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH116620.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00002702

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 1071nts         Open reading frame : 1 to 1071
Reference Sequence Alignment

ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAG
GAGCAGGCGGCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTG
TACGGACCATCAGGTGCTGGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTAT
GGTGTTGGAGTGGAAAAATTGAGAATTGAACATCAGACCATCACAACTCCATCTAAAAAA
AAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTGAAGTTAATCCTAGTGATGCT
GGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACAATCACAACAA
CTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGA
TTGATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTG
GCGGTTCGTGTGCCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGT
AAGAAGGAAGGTCTGAATCTTCCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGT
AGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCAGAGTGCAACAATATCCTTTT
ACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGAGACTGCAAAT
GCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGGCCTTCTCTCAGAACTGTTA
CATAATTGTGATGGACAACTGAAAGGGGAGGTGGCACAAATGGCAGCTTACTATGAGCAT
CGTCTACAGCTGGGTAGCAAAGCCATTTATCACTTGGAAGCGTTTGTGGCCAAATTCATG
GCACTTTATAAGAAGTTCATGGAGGATGGATTGGAAGGCATGATGTTCTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1112
Start on reference sequence 42
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : RFC3
Symbol Nomenclature : RFC3
SYNONYM : RFC38
Designation : A1 38 kDa subunit|RF-C 38 kDa subunit|RFC, 38 kD subunit|activator 1 38 kDa subunit|activator 1 subunit 3|replication factor C 38 kDa subunit|replication factor C subunit 3
Full Nomenclature : replication factor C (activator 1) 3, 38kDa
GENEID : 5983
GI : 61371557
GenBank Accession : AY891762
HGNC : 9971
MIM : 600405
Vega : OTTHUMG00000016715
Target GenBank: BC000149

 

Reference Sequence Alignment

  

HsCD00002702      ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAG
NM_002915.3       ATGAGCCTCTGGGTGGACAAGTATCGGCCCTGCTCCTTGGGACGGCTGGACTATCACAAG
                  ************************************************************

HsCD00002702      GAGCAGGCGGCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTG
NM_002915.3       GAGCAGGCGGCCCAGCTGCGGAACCTGGTGCAGTGTGGTGACTTTCCTCATCTGTTAGTG
                  ************************************************************

HsCD00002702      TACGGACCATCAGGTGCTGGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTAT
NM_002915.3       TACGGACCATCAGGTGCTGGAAAAAAGACAAGAATTATGTGTATTCTACGTGAACTTTAT
                  ************************************************************

HsCD00002702      GGTGTTGGAGTGGAAAAATTGAGAATTGAACATCAGACCATCACAACTCCATCTAAAAAA
NM_002915.3       GGTGTTGGAGTGGAAAAATTGAGAATTGAACATCAGACCATCACAACTCCATCTAAAAAA
                  ************************************************************

HsCD00002702      AAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTGAAGTTAATCCTAGTGATGCT
NM_002915.3       AAAATTGAAATTAGCACCATTGCAAGTAACTACCACCTTGAAGTTAATCCTAGTGATGCT
                  ************************************************************

HsCD00002702      GGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACAATCACAACAA
NM_002915.3       GGAAATAGTGACCGAGTAGTCATTCAGGAGATGTTGAAAACAGTGGCACAATCACAACAA
                  ************************************************************

HsCD00002702      CTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
NM_002915.3       CTTGAAACAAACTCTCAAAGGGATTTTAAAGTGGTATTATTGACAGAAGTTGACAAACTC
                  ************************************************************

HsCD00002702      ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGA
NM_002915.3       ACCAAAGATGCTCAGCATGCCTTGCGAAGAACCATGGAAAAATATATGTCTACCTGCAGA
                  ************************************************************

HsCD00002702      TTGATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTG
NM_002915.3       TTGATCTTGTGCTGCAATTCTACATCTAAAGTGATCCCACCTATTCGTAGTAGGTGCTTG
                  ************************************************************

HsCD00002702      GCGGTTCGTGTGCCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGT
NM_002915.3       GCGGTTCGTGTGCCTGCTCCCAGCATTGAAGATATTTGCCACGTGTTATCTACTGTGTGT
                  ************************************************************

HsCD00002702      AAGAAGGAAGGTCTGAATCTTCCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGT
NM_002915.3       AAGAAGGAAGGTCTGAATCTTCCTTCACAACTGGCTCATAGACTTGCAGAGAAGTCTTGT
                  ************************************************************

HsCD00002702      AGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCAGAGTGCAACAATATCCTTTT
NM_002915.3       AGAAATCTCAGAAAAGCCCTGCTTATGTGTGAAGCCTGCAGAGTGCAACAATATCCTTTT
                  ************************************************************

HsCD00002702      ACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGAGACTGCAAAT
NM_002915.3       ACTGCAGATCAAGAAATCCCTGAGACAGATTGGGAGGTGTATCTGAGGGAGACTGCAAAT
                  ************************************************************

HsCD00002702      GCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
NM_002915.3       GCTATTGTCAGTCAGCAAACTCCACAAAGGCTCCTTGAAGTTCGTGGAAGGCTGTATGAG
                  ************************************************************

HsCD00002702      CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGGCCTTCTCTCAGAACTGTTA
NM_002915.3       CTTCTAACTCATTGTATTCCTCCTGAGATAATAATGAAGGGCCTTCTCTCAGAACTGTTA
                  ************************************************************

HsCD00002702      CATAATTGTGATGGACAACTGAAAGGGGAGGTGGCACAAATGGCAGCTTACTATGAGCAT
NM_002915.3       CATAATTGTGATGGACAACTGAAAGGGGAGGTGGCACAAATGGCAGCTTACTATGAGCAT
                  ************************************************************

HsCD00002702      CGTCTACAGCTGGGTAGCAAAGCCATTTATCACTTGGAAGCGTTTGTGGCCAAATTCATG
NM_002915.3       CGTCTACAGCTGGGTAGCAAAGCCATTTATCACTTGGAAGCGTTTGTGGCCAAATTCATG
                  ************************************************************

HsCD00002702      GCACTTTATAAGAAGTTCATGGAGGATGGATTGGAAGGCATGATGTTCTTG
NM_002915.3       GCACTTTATAAGAAGTTCATGGAGGATGGATTGGAAGGCATGATGTTCTGA
                  ************************************************* .

Pathways

NCI : ATR signaling pathway
NCI : Fanconi anemia pathway
Panther : DNA replication
Reactome : Activation of ATR in response to replication stress
Reactome : Cell Cycle
Reactome : Cell Cycle Checkpoints
Reactome : Cell Cycle, Mitotic
Reactome : Chromosome Maintenance
Reactome : DNA Repair
Reactome : DNA Replication
Reactome : DNA strand elongation
Reactome : Extension of Telomeres
Reactome : G2/M Checkpoints
Reactome : Gap-filling DNA repair synthesis and ligation in GG-NER
Reactome : Gap-filling DNA repair synthesis and ligation in TC-NER
Reactome : Global Genomic NER (GG-NER)
Reactome : Lagging Strand Synthesis
Reactome : Leading Strand Synthesis
Reactome : Nucleotide Excision Repair
Reactome : Polymerase switching
Reactome : Polymerase switching on the C-strand of the telomere
Reactome : Repair synthesis for gap-filling by DNA polymerase in TC-NER
Reactome : Repair synthesis of patch ~27-30 bases long by DNA polymerase
Reactome : S Phase
Reactome : Synthesis of DNA
Reactome : Telomere C-strand (Lagging Strand) Synthesis
Reactome : Telomere Maintenance
Reactome : Transcription-coupled NER (TC-NER)
WikiPathway : DNA Replication

Protein

SMART domain : AAA : ATPases associated with a variety of cellular activities
UniProt : C9JU95
UniProt : P40938
HPRD : 02676

Clone

Cloning Information : 116620
HIP Master Clone ID : 92466
Original Clone ID : FLH116620.01L

Organism


TAX_ID : 9606
Species Specific ID: 5983

Genome

Chromosome : 13
Map Location : 13q13.2
Ensembl : ENSG00000133119

Reagents

Labome : RFC3-antibody