DNASU Plasmid Repository • 480.965.5697 | Email

CPSF5 (Homo sapiens) in pDNR-Dual (Creator donor/master vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  NUDT21
Gene Name:  nudix (nucleoside diphosphate linked moiety X)-type motif 21
Sequence              Map: pDNR-Dual_with_human_insert.pdf
Original Clone ID: FLH027706.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDNR-Dual               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: PMID: 16512675
Title: Functional proteomics approach to investigate the biological activities of cDNAs implicated in breast cancer.
Authors: HIP
HsCD00002813

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

 

Insert sequence: 684nts         Open reading frame : 1 to 684
Reference Sequence Alignment

ATGTCTGTGGTACCGCCCAATCGCTCGCAGACCGGCTGGCCCCGGGGGGTCACTCAGTTC
GGCAACAAGTACATCCAGCAGACGAAGCCCCTCACCCTGGAGCGCACCATCAACCTGTAC
CCTCTTACCAATTATACTTTTGGTACAAAAGAGCCCCTCTACGAGAAGGACAGCTCTGTT
GCAGCCAGATTTCAGCGCATGAGGGAAGAATTTGATAAAATTGGAATGAGGAGGACTGTA
GAAGGGGTTCTGATTGTACATGAGCACCGGCTACCCCATGTGTTACTGCTGCAGCTGGGA
ACAACTTTCTTCAAACTACCTGGTGGTGAACTTAACCCAGGAGAAGATGAAGTTGAAGGA
CTAAAACGCTTAATGACAGAGATACTGGGTCGTCAGGATGGAGTTTTGCAAGACTGGGTC
ATTGACGATTGCATTGGTAACTGGTGGAGACCAAATTTTGAACCTCCTCAGTATCCATAT
ATTCCTGCACATATTACAAAGCCTAAGGAACATAAGAAGTTGTTTCTGGTTCAGCTTCAA
GAAAAAGCCTTGTTTGCAGTCCCTAAAAATTACAAGCTGGTAGCTGCACCATTGTTTGAA
TTGTATGACAATGCACCAGGATATGGACCCATCATTTCTAGTCTCCCTCAGCTGTTGAGC
AGGTTCAATTTTATTTACAACTTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 801
Start on reference sequence 118
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
5P GCGGCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCAGTC
GACACC(ATG-GOI)

3' Linker Sequence:
5p (goi-stop)GGAAGCTTTCTAGACCATTCGTTTGGCGCGCGGGCCC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pDNR-Dual

pDNR-Dual in advanced viewed

Synonyms: None
Sequencing Primer: Forward:  M13F
Reverse:  Unknown
Description: Recombinational donor/master vector with 6xHN tag ORF, T7 and M13 primer sites; ampicillin resistance; restriction enzyme cloning (into) and recombinational cloning (from).
Comments: The position of features were detemined for the empty form of the vector, which is described in detail on the BD/Clontech website. Subcloning into the MCS was performed using the infusion reaction strategy and some restriction sites in the MCS may be lost after an insert is added.
Size (bp): 4938
Parent Vector: None
Empty Vector: None
Properties: Creator, donor (entry), loxP, multiple cloning site, recombinational cloning, with tag/fusion/marker
Author Name: BD Biosciences Clontech
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
MCS MCS restriction enzyme-type multiple cloning site 45 129
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4111 4574
negative selection marker SacB SacB negative selection marker gene (sucrose sensitivity) 1057 2972
primer site M13 primer M13 primer sequencing site 4839 4855
primer site T7 primer T7 RNA Pol primer sequencing site 4865 4883
recombination site loxP site loxP recombination site 1015 1048
recombination site loxP site loxP recombination site 9 42
selectable marker CmR chloramphenicol resistance gene ORF (functional only after recombination of insert into vector with promoter) 986 327
selectable marker AmpR ampicillin resistance gene 3103 3963
splice donor site SD site splice donor site 132 136
tag HN 6xHN epitope tag 141 176

 

  • Gene
  • Pathways
  • Protein
  • Clone
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : NUDT21
Symbol Nomenclature : NUDT21
SYNONYM : CFIM25; CPSF5
Designation : CPSF 25 kDa subunit|cleavage and polyadenylation specific factor 5, 25 kD subunit|cleavage and polyadenylation specific factor 5, 25 kDa|cleavage and polyadenylation specificity factor 25 kDa subunit|cleavage and polyadenylation specificity factor subunit 5|cleavage factor Im complex 25 kDa subunit|nucleoside diphosphate-linked moiety X motif 21|nudix motif 21|pre-mRNA cleavage factor Im (25kD)|pre-mRNA cleavage factor Im 25 kDa subunit|pre-mRNA cleavage factor Im, 25kD subunit
Full Nomenclature : nudix (nucleoside diphosphate linked moiety X)-type motif 21
GENEID : 11051
GI : 61371856
GenBank Accession : AY891817
HGNC : 13870
MIM : 604978
Vega : OTTHUMG00000133240
Target GenBank: BC001403

 

Reference Sequence Alignment

  

HsCD00002813      ATGTCTGTGGTACCGCCCAATCGCTCGCAGACCGGCTGGCCCCGGGGGGTCACTCAGTTC
NM_007006.2       ATGTCTGTGGTACCGCCCAATCGCTCGCAGACCGGCTGGCCCCGGGGGGTCACTCAGTTC
                  ************************************************************

HsCD00002813      GGCAACAAGTACATCCAGCAGACGAAGCCCCTCACCCTGGAGCGCACCATCAACCTGTAC
NM_007006.2       GGCAACAAGTACATCCAGCAGACGAAGCCCCTCACCCTGGAGCGCACCATCAACCTGTAC
                  ************************************************************

HsCD00002813      CCTCTTACCAATTATACTTTTGGTACAAAAGAGCCCCTCTACGAGAAGGACAGCTCTGTT
NM_007006.2       CCTCTTACCAATTATACTTTTGGTACAAAAGAGCCCCTCTACGAGAAGGACAGCTCTGTT
                  ************************************************************

HsCD00002813      GCAGCCAGATTTCAGCGCATGAGGGAAGAATTTGATAAAATTGGAATGAGGAGGACTGTA
NM_007006.2       GCAGCCAGATTTCAGCGCATGAGGGAAGAATTTGATAAAATTGGAATGAGGAGGACTGTA
                  ************************************************************

HsCD00002813      GAAGGGGTTCTGATTGTACATGAGCACCGGCTACCCCATGTGTTACTGCTGCAGCTGGGA
NM_007006.2       GAAGGGGTTCTGATTGTACATGAGCACCGGCTACCCCATGTGTTACTGCTGCAGCTGGGA
                  ************************************************************

HsCD00002813      ACAACTTTCTTCAAACTACCTGGTGGTGAACTTAACCCAGGAGAAGATGAAGTTGAAGGA
NM_007006.2       ACAACTTTCTTCAAACTACCTGGTGGTGAACTTAACCCAGGAGAAGATGAAGTTGAAGGA
                  ************************************************************

HsCD00002813      CTAAAACGCTTAATGACAGAGATACTGGGTCGTCAGGATGGAGTTTTGCAAGACTGGGTC
NM_007006.2       CTAAAACGCTTAATGACAGAGATACTGGGTCGTCAGGATGGAGTTTTGCAAGACTGGGTC
                  ************************************************************

HsCD00002813      ATTGACGATTGCATTGGTAACTGGTGGAGACCAAATTTTGAACCTCCTCAGTATCCATAT
NM_007006.2       ATTGACGATTGCATTGGTAACTGGTGGAGACCAAATTTTGAACCTCCTCAGTATCCATAT
                  ************************************************************

HsCD00002813      ATTCCTGCACATATTACAAAGCCTAAGGAACATAAGAAGTTGTTTCTGGTTCAGCTTCAA
NM_007006.2       ATTCCTGCACATATTACAAAGCCTAAGGAACATAAGAAGTTGTTTCTGGTTCAGCTTCAA
                  ************************************************************

HsCD00002813      GAAAAAGCCTTGTTTGCAGTCCCTAAAAATTACAAGCTGGTAGCTGCACCATTGTTTGAA
NM_007006.2       GAAAAAGCCTTGTTTGCAGTCCCTAAAAATTACAAGCTGGTAGCTGCACCATTGTTTGAA
                  ************************************************************

HsCD00002813      TTGTATGACAATGCACCAGGATATGGACCCATCATTTCTAGTCTCCCTCAGCTGTTGAGC
NM_007006.2       TTGTATGACAATGCACCAGGATATGGACCCATCATTTCTAGTCTCCCTCAGCTGTTGAGC
                  ************************************************************

HsCD00002813      AGGTTCAATTTTATTTACAACTTG
NM_007006.2       AGGTTCAATTTTATTTACAACTGA
                  ********************** .

Pathways

Reactome : Cleavage of Growing Transcript in the Termination Region
Reactome : Gene Expression
Reactome : Post-Elongation Processing of Intron-Containing pre-mRNA
Reactome : Post-Elongation Processing of Intronless pre-mRNA
Reactome : Post-Elongation Processing of the Transcript
Reactome : Processing of Capped Intron-Containing Pre-mRNA
Reactome : Processing of Capped Intronless Pre-mRNA
Reactome : Processing of Intronless Pre-mRNAs
Reactome : RNA Polymerase II Transcription
Reactome : RNA Polymerase II Transcription Termination
Reactome : Transcription
Reactome : mRNA 3'-end processing
Reactome : mRNA Splicing
Reactome : mRNA Splicing - Major Pathway
WikiPathway : mRNA processing

Protein

UniProt : O43809
HPRD : 05400

Clone

Cloning Information : 27706
HIP Master Clone ID : 58082
Original Clone ID : FLH027706.01L

Organism


TAX_ID : 9606
Species Specific ID: 11051

Genome

Chromosome : 16
Map Location : 16q12.2
Ensembl : ENSG00000167005

Reagents

Labome : NUDT21-antibody