DNASU Plasmid Repository • 480.965.5697 | Email

TM1848 (Thermotoga maritima) in pMH2T7 (bacterial expression vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  TM1848
Gene Name:  cellobiose-phosphorylase
Sequence             
Original Clone ID: 8003
Keyword: None
Species: Thermotoga maritima
Type: cDNA
Vector Name: pMH2T7               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
TmCD00282214

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 2442nts         Open reading frame : 37 to 2478

ATGGGATCTGATAAAATTCATCATCATCATCATCACGTGCGATTCGGTTATTTTGATGAC
GTCAACCGTGAATACGTGATCACAACTCCTCAAACTCCGTATCCATGGATAAATTACCTG
GGAACGGAGGACTTCTTTTCCATCATATCTCACATGGCAGGGGGTTACTGTTTTTACAAA
GACGCGAGACTCAGAAGAATAACGAGGTTCAGATACAACAACGTTCCAACGGATGCTGGA
GGAAGGTACTTTTACATCAGAGAAGAAAATGGAGATTTCTGGACACCCACGTGGATGCCT
GTGAGAAAAGATCTTTCCTTCTTTGAAGCGCGCCACGGTCTTGGATACACAAAGATCACA
GGTGAAAGGAACGGCCTGAGAGCCACCATCACCTACTTTGTGCCAAGGCATTTCACAGGA
GAAGTTCATTACCTCGTTCTGGAGAACAAAGCAGAGAAGCCAAGGAAAATAAAGCTTTTC
TCCTTTATAGAGTTCTGCCTCTGGAACGCTCTCGATGATATGACCAACTTCCAGAGAAAC
TACAGTACGGGTGAAGTGGAAATAGAAGGTTCTGTGATTTACCACAAGACAGAATACAGA
GAAAGAAGAAACCACTACGCGTTCTATTCTGTGAATCAACCGATAGATGGTTTTGACACA
GACAGAGAATCCTTCATAGGTCTCTACAGCGGTTTTGAAGCTCCTCAAGCGGTGGTGGAA
GGAAAACCCAGAAATTCCGTCGCGAGCGGGTGGGCACCGATCGCTTCACATTACTTAGAG
ATAGAACTCGCTCCATCCGAAAAGAAAGAACTCATCTTCATTCTCGGGTACGTAGAGAAT
CCAGAGGAAGAAAAATGGGAAAAGCCCGGTGTGATAAACAAAAAGCGAGCAAAAGAGATG
ATAGAAAAATTCAAAACAGGTGAAGATGTTGAGCACGCCCTGAAGGAGCTTAGAGAATAC
TGGGACGACCTTCTTGGAAGAATACAGGTAGAAACCCATGACGAAAAACTCAACAGAATG
GTGAACATCTGGAATCAGTACCAGTGTATGGTCACATTCAACATATCTCGAAGCGCTTCG
TACTTCGAGTCTGGAATCAGTAGAGGAATAGGTTTCAGGGACTCGAACCAGGATATCCTG
GGTTTTGTTCACATGATCCCGGAGAAGGCAAGGCAGAGAATACTCGATTTGGCCTCTATC
CAATTCGAGGATGGAAGCACTTACCACCAGTTCCAGCCGCTCACCAAGAAGGGCAACAAC
GAAATAGGAGGAGGCTTCAACGACGATCCGCTTTGGCTCATTCTCTCAACGAGCGCTTAC
ATCAAAGAGACAGGTGACTGGAGCATACTGGGCGAAGAGGTTCCCTTCGACAACGATCCG
AACAAAAAGGCATCACTCTTTGAGCATCTGAAGAGATCTTTCTACTTCACTGTGAACAAC
CTCGGCCCCCATGGTCTTCCATTGATAGGAAGGGCCGATTGGAACGATTGTCTCAACCTC
AATTGTTTCTCGAAAAATCCCGATGAGTCCTTCCAAACAACCGTCAACGCCCTCGACGGA
AGGGTAGCGGAGTCCGTCTTCATAGCGGGGCTCTTCGTTCTTGCCGGAAAAGAGTTCGTG
GAGATCTGCAAAAGACGAGGACTTGAGGAAGAAGCGAGAGAAGCGGAAAAACATGTGAAC
AAAATGATCGAGACCACTCTGAAATACGGCTGGGATGGTGAATGGTTCCTCAGGGCGTAC
GATGCCTTTGGGAGAAAGGTGGGAAGCAAAGAGTGTGAAGAAGGTAAGATCTTCATAGAA
CCACAGGGAATGTGTGTTATGGCAGGTATCGGTGTGGACAACGGATACGCGGAAAAAGCT
CTCGATTCTGTCAAGAAATATCTCGACACACCCTACGGACTCGTTCTTCAGCAGCCGGCG
TACAGCAGATATTACATCGAGCTTGGTGAGATCTCGAGTTATCCACCGGGCTACAAAGAA
AACGCGGGGATCTTCTGTCACAACAATCCATGGGTAGCGATAGCCGAGACTGTTATAGGT
AGGGGAGACAGAGCCTTTGAGATCTACAGAAAAATCACACCGGCTTATCTCGAAGACATC
AGCGAAATACACAGGACTGAGCCGTACGTCTACGCTCAGATGGTTGCCGGAAAAGATGCA
CCGAGGCATGGAGAGGCGAAGAATTCCTGGCTCACGGGGACTGCTGCTTGGAGCTTTGTG
GCGATCACTCAGCATATACTCGGGATAAGGCCTACTTACGACAGCCTGGTAGTGGATCCC
TGCATCCCGAAAGAATGGGAAGGATTCAGGATCACAAGAAAGTTCAGAGGAAGCATCTAC
GATATAACGGTGAAGAATCCCTCTCATGTTTCCAAAGGTGTGAAAGAGATCATTGTTGAC
GGGAAAAAGATAGAAGGGCAAGTACTTCCGGTTTTCGAGGATGGAAAGGTGCACAGGGTT
GAAGTTGTGATGGGCTAA


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 2442
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in 283700
Recommended expression in: DL41
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH2T7

pMH2T7 in advanced viewed

Synonyms: pMH-2-T7
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial (E. coli) expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enzyme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 4084
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColEI origin of replication 1921 2603
promoter T7 T7 promoter 290 310
promoter araC araC promoter 256 285
selectable marker AmpR ampicillin resistance gene 1164 1823
tag His N-terminal 6x His tag 367 381
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism

Gene

 

Gene Symbol : TM1848
GENEID : 897337
Locus Tag : TM1848
Target GenBank: NP_229644

 

Protein

SMART domain : CBM_X : Putative carbohydrate binding domain
Structural Annotation Wiki : TOPSAN
Swissprot ID : Q9X2G3

Clone

Cloning Information : 276848
HIP Master Clone ID : 206334
Original Clone ID : 8003

Experimental

TargetTrack - Experimental data : 283700

Organism


TAX_ID : 243274
Species Specific ID: 897337