DNASU Plasmid Repository • 480.965.5697 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  None
Gene Name:  None
Sequence             
Original Clone ID: 14272
Keyword: None
Species: Enterococcus faecalis V583
Type: cDNA
Vector Name: pMH4               Format:  CLOSED
Source: Joint Center for Structural Genomics
Description: None
Comments: None
Mutation/
Discrepancy :
No / No
Publications: None
Authors: PSI
Joint Center for Structural Genomics
EfCD00282617

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 1074nts         Open reading frame : 37 to 1110

ATGGGATCTGATAAAATTCATCATCATCATCATCACATGTACGATCAATTACAATCTATT
GAAGATCGCTATGAGGAATTGGGCGAATTATTAAGTGACCCAGCAGTCATTAGTGATACA
AAACGTTTCATGGAATTATCGAAGGAAGAAGCTAATACACGTGAGACGGTTGAGGTTTAT
CGCCGATATAAACAAGTTGTTGAAGGGATTAGCGATGCCGAAGAACTTTTAAGTGAAAAC
TTAGATGCGGAAATGGCCGAAATGGCGAAAGAAGAACTTTCTGATTTGAAAAAAGAAAAA
GAAGTGTTAGAAGACCGCATTAAAATTTTATTATTACCAAAAGATCCAAATGATGATAAA
AACATCATCATGGAAATCCGTGGTGCAGCCGGTGGCGATGAAGCCGCACTTTTTGCTGGC
GACTTATTTAATATGTACCAAAAATATGCAGAAGCACAAGGGTGGAAAGCGGAAGTTTTA
GAAGCGAACGTCACTGGAATCGGTGGATATAAAGAAGTAATTATGATGATTTCAGGAGAT
AACGTCTTTTCAAAATTAAAATATGAAAGTGGCGCTCACCGCGTGCAACGAGTTCCTTCA
ACAGAATCACAAGGACGGATTCATACATCGACAGCAACCGTTGTAGTTATGCCGGAAGCG
GAAGAAGTCGAAATCGAATTAGCTGATAAAGATATCCGTGTCGATATTTATCATGCAAGT
GGCGCTGGTGGACAGCACGTCAATAAAACCGCTTCGGCTGTTCGATTAACCCATTTACCA
ACAGGAATCGTAGTCGCAATGCAAGATGAACGTTCACAGCTAAAAAACCGTGAAAAAGCA
ATGAAAGTTTTGCGTGCTCGTGTGTATGACCAAATTCAACAAGAAGCACAAAGTGAATAT
GATGCTAACCGTAAATCGGCGGTGGGGACCGGAGATCGTTCAGAACGAATCAGAACGTAT
AACTTCCCGCAAAATCGAGTAACGGATCATCGTATCGGTTTAACCATCCAAAAACTAGAC
CAGATTCTTGCTGGCAAATTAGATGAAATCATTGATGCATTAGTCTTATATGATCAAACA
TCGAAATTAGAAGAGATGCAAAATGGCTAACGCGACTTAATTAACTCTAGATAACTG


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 1074
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGGGATCTGATAAAATTCATCATCATCATCATCAC

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
ProteinExpressed: Protein_Confirmed
Find experimental protocols in 357273
Recommended expression in: HK100
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pMH4

pMH4 in advanced viewed

Synonyms: pMH-4
Sequencing Primer: Forward:  pBAD forward
Reverse:  alt_bad_rev
Description: Bacterial expression vector, arabinose or T7 induced expression, adds N-terminal MGSDKIHHHHHH tag; amp resistance; restriction enyzme (Pml I/Pac I) or PIPE cloning.
Comments: None
Size (bp): 5489
Parent Vector: None
Empty Vector: None
Properties: PIPE cloning, bacterial expression, in vitro transcription, inducible expression, with tag/fusion/marker
Author Name: Joint Center for Structural Genomics
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin ori ColE1 bacterial origin of replication 3331 4013
inducible trxn activator protein gene araC araC cds 5463 4585
negative selection marker ccdB ccdB negative selection gene (may be gone in with-insert form) 1576 1785
promoter T7 T7 promoter 290 310
promoter araC araC promoter 153 124
selectable marker CmR chloramphenicol resistance gene (CmR) 484 1140
selectable marker AmpR ampicillin resistance gene 2574 3233
tag His N-terminal 6xHis tag 364 381
trxn regulatory element arabinose O1 operator arabinose O1 operator 161 182
trxn regulatory element arabinose O2 operator arabinose O2 operator 5 23
trxn termination sequence rrnB rrnB T2 transcription terminator 2238 2264

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Reagents

Gene

Target GenBank: NP_816196

 

Protein

SMART domain : PCRF :
Structural Annotation Wiki : TOPSAN
UniProt : Q831F6

Clone

Cloning Information : 281519
HIP Master Clone ID : 211005
Original Clone ID : 14272

Experimental

TargetTrack - Experimental data : 357273

Reagents

Labome : prfA-cDNA