DNASU Plasmid Repository • 480.965.2857 | Email

Detailed Plasmid Information

TOP

Explanation of Terms


Gene: Gene Symbol:  None
Gene Name:  None
Sequence             
Original Clone ID: 2829h1TCt7b1
Keyword: None
Species: Campylobacter jejuni
Type: cDNA
Vector Name: pSB3               Format:  CLOSED
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "C-terminal 6-His, TOPO"
Mutation/
Discrepancy :
No / No
Publications: PMID: 16477602
Title: Crystal structures of two putative phosphoheptose isomerases.
Authors: PSI
New York SGX Research Center for Structural Genomics
CjCD00285289

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 588nts         Open reading frame : 51 to 638

CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCTTATAAATTTAG
TGGAAAAAGAATGGCAAGAACATCAAAAAATTGTTCAAGCAAGCGAAATTTTAAAAGGAC
AAATCGCTAAAGTAGGTGAGCTTTTGTGTGAGTGTCTTAAAAAAGGTGGTAAAATTTTAA
TTTGCGGAAACGGTGGAAGTGCGGCTGATGCTCAGCATTTTGCGGCTGAACTTAGCGGGC
GTTATAAAAAAGAACGCAAGGCTTTAGCAGGCATAGCACTTACAACCGATACTTCAGCAC
TTAGTGCCATAGGAAATGACTATGGTTTTGAGTTTGTTTTTTCAAGACAAGTGGAAGCTT
TAGGGAATGAAAAGGATGTTTTAATCGGTATTTCAACGAGCGGAAAAAGCCCTAATGTTT
TAGAAGCTTTAAAAAAAGCAAAAGAGCTTAATATGCTTTGTCTAGGGCTTAGCGGAAAAG
GTGGTGGAATGATGAATAAGCTTTGTGATCATAATCTTGTTGTGCCAAGCGATGATACAG
CTAGAATTCAAGAAATGCACATTTTAATCATACACACACTTTGTCAGATCATAGATGAGA
GTTTTGAAGGGGGATCCCACCACCACCACCACCACTGAGATCCGAATTCGAGCTCCGTCG
ACAAGCTTGCGGCCGCACTCGAGCACC


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 588
Start on reference sequence 1
Mutations:
None
Discrepancy:
None
5' Linker Sequence:
ATGTCCCTT

3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Purified
SolubleProtein: Protein_Soluble
Find experimental protocols in NYSGXRC-2829h
Recommended expression in: BL21 (DE3)
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pSB3

pSB3 in advanced viewed

Synonyms: pSB-3, pSB3_TC
Sequencing Primer: Forward:  T7
Reverse:  T7 terminator
Description: Bacterial (E. coli) expression vector with T7 promoter, adds C-terminal 6xHis tag; kanamycin resistance; TOPO cloning.
Comments: TOPO modified pSB3 vector -by Invitrogen. Addition of an extra G to the reverse primer which puts the vector-encoded C-terminal His-tag in-frame with the insert.
Size (bp): 5339
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning, bacterial expression, in vitro transcription, with tag/fusion/marker
Author Name: NYSGXRC
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
ATG start start Initiation start (Met, Ser, Leu) 5072 5080
TOPO recognition site TOPO TOPO cloning site 5076 5085
bacterial origin ori pBR322-type bacterial origin of replication 1421 2103
gene fragment ROP ROP 2527 2703
promoter T7 T7 promoter 4984 5003
repressor protein gene LacI LacI cds 3515 4531
selectable marker KanR kanamycin resistance gene 563 1375
tag His 6xHis tag 5092 5109
trxn regulatory element lac operator lac operator 5003 5025
trxn termination sequence T7 term T7 terminator 5243 5289

 


Cloning Information: 460541
HIP Master Clone ID: 390027
Original Clone ID: 2829h1TCt7b1
Structural Annotation Wiki: TOPSAN
TargetTrack - Experimental data: NYSGXRC-2829h
Species Specific ID: None
Target GenBank: NP_282296.1