DNASU Plasmid Repository • 480.965.5697 | Email

PTPN3 (Homo sapiens) in pCR4zeroBLUNT-TOPO (TOPO cloning vector)

TOP

Explanation of Terms


Gene: Gene Symbol:  PTPN3
Gene Name:  protein tyrosine phosphatase, non-receptor type 3
Sequence             
Original Clone ID: 8603a1ZBt2
Keyword: intended mutation
Species: Homo sapiens
Type: cDNA
Vector Name: pCR4zeroBLUNT-TOPO               Format:  FUSION
Source: New York SGX Research Center for Structural Genomics
Description: None
Comments: "Invitrogen Zero Blunt, TOPO"
Mutation/
Discrepancy :
Yes / Yes
Publications: None
Authors: PSI
New York SGX Research Center for Structural Genomics
HsCD00285675

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: PSI

 

Insert sequence: 942nts         Open reading frame : 11 to 952
Reference Sequence Alignment

ATTCGCCCTTCGCTCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCC
CGAAGCCATTTTCCCCATGTATCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACA
GCTAAAGAAGGGCCTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAA
AAAGCCAGGTTTGGCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATA
TAAAGATGTGCTGCCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATAT
TAATGCAAGTTACGTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGC
CACTCAGGGGCCCCTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAA
GTTGTCACTCATTGTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCA
GTACTGGCCAGATCCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTC
AGAGGACTGCACCATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGG
GGAAGAACACACAGTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGA
TGACTCCTCCGACTTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGA
GCCCGTCCTAGTTCACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGA
AACAGCCATGTGCCTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAA
AATGCGAGACCAGCGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGA
AGCGATTCTTCGTGTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTAAGGGGCG
AATTCGT


Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 942
Start on reference sequence 1
Mutations:
C623Y; L838V;

Discrepancy:
g940a,a942t,G314S;
                                

5' Linker Sequence: None
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50 ug/mL ampicillin
Growth Condition:  Growth at 37 degrees C in LB supplemented with ampicillin (50 ug/mL)
Comments:  None
Protein Expression Results: ProteinExpressed: Not_Applicable
SolubleProtein: Not_Applicable
ProteinPurified: Not_Applicable
Find experimental protocols in NYSGXRC-8603a
Recommended expression in: TOP10
       DyNA Vector Map

         Powered by LabGenius

Vector Name: pCR4zeroBLUNT-TOPO

pCR4zeroBLUNT-TOPO in advanced viewed

Synonyms: pCR-4, pCR-IV, pCR4, pCR4-TOPO
Sequencing Primer: Forward:  M13F
Reverse:  M13R
Description: TOPO cloning vector with M13 forward/reverse, T3, and T7 primers. Ampicillin and kanamycin resistance bacteria.
Comments: Empty vector is a product available from Invitrogen.
Size (bp): 3956
Parent Vector: None
Empty Vector: None
Properties: TOPO Cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:

 



Vector Features:

Type Name Description Start Position End Position
bacterial origin pUC ori pUC bacterial origin of replication 3161 3834
primer site T3 T3 priming site 243 262
primer site M13 forward M13 forward priming site 355 370
primer site M13 reverse M13 reverse priming site 205 221
primer site T7 T7 priming site 328 347
promoter lac lac promoter region 2 216
selectable marker KanR Kanamycin resistance gene 1159 1953
selectable marker AmpR Ampicillin resistance gene 2203 3063

 

  • Gene
  • Protein
  • Clone
  • Experimental
  • Organism
  • Genome
  • Reagents

Gene

 

Gene Symbol : PTPN3
Symbol Nomenclature : PTPN3
SYNONYM : PTP-H1; PTPH1
Designation : cytoskeletal-associated protein tyrosine phosphatase|protein-tyrosine phosphatase H1|tyrosine-protein phosphatase non-receptor type 3
Full Nomenclature : protein tyrosine phosphatase, non-receptor type 3
GENEID : 5774
Locus Tag : RP11-18A3.3
HGNC : 9655
MIM : 176877
Vega : OTTHUMG00000020475
Target GenBank: NP_002820

 

Reference Sequence Alignment

  

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      ATGACCTCCCGGTTACGTGCGTTGGGTGGAAGAATTAATAATATACGCACCTCGGAGTTA
NM_002829.3         ATGACCTCCCGGTTACGTGCGTTGGGTGGAAGAATTAATAATATACGCACCTCGGAGTTA
NM_001145369.1      ------------------------------------------------------------
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      CCCAAAGAGAAAACTCGATCAGAAGTCATTTGCAGCATCCACTTTTTAGATGGCGTGGTA
NM_002829.3         CCCAAAGAGAAAACTCGATCAGAAGTCATTTGCAGCATCCACTTTTTAGATGGCGTGGTA
NM_001145369.1      ------------------------------------------------------------
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      CAGACCTTTAAAGTTACTAAACAAGACACTGGCCAGGTTCTTCTGGATATGGTGCACAAC
NM_002829.3         CAGACCTTTAAAGTTACTAAACAAGACACTGGCCAGGTTCTTCTGGATATGGTGCACAAC
NM_001145369.1      ------------------------------------------------------------
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      CACCTGGGTGTGACTGAAAAGGAATATTTTGGTTTACAGCATGATGACGACTCCGTGGAC
NM_002829.3         CACCTGGGTGTGACTGAAAAGGAATATTTTGGTTTACAGCATGATGACGACTCCGTGGAC
NM_001145369.1      ------------------------------------------------------------
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TCTCCTAGATGGCTGGAAGCAAGCAAAGCCATCAGGAAGCAGTTAAAAGGAGGTTTCCCC
NM_002829.3         TCTCCTAGATGGCTGGAAGCAAGCAAAGCCATCAGGAAGCAGTTAAAAGGAGGTTTCCCC
NM_001145369.1      ------------------------------------------------------------
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TGTACCCTGCATTTTCGAGTAAGATTTTTTATACCTGATCCCAACACACTGCAGCAAGAA
NM_002829.3         TGTACCCTGCATTTTCGAGTAAGATTTTTTATACCTGATCCCAACACACTGCAGCAAGAA
NM_001145369.1      ------------------------------------------------------------
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      CAAACCAGGCACTTGTATTTCTTACAACTGAAGATGGATATTTGCGAAGGAAGGTTAACC
NM_002829.3         CAAACCAGGCACTTGTATTTCTTACAACTGAAGATGGATATTTGCGAAGGAAGGTTAACC
NM_001145369.1      ---------------------------------ATGGATATTTGCGAAGGAAGGTTAACC
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ---------------------------------ATGGATATTTGCGAAGGAAGGTTAACC
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TGCCCTCTTAACTCAGCAGTGGTTCTAGCGTCCTATGCCGTACAATCTCATTTTGGAGAC
NM_002829.3         TGCCCTCTTAACTCAGCAGTGGTTCTAGCGTCCTATGCCGTACAATCTCATTTTGGAGAC
NM_001145369.1      TGCCCTCTTAACTCAGCAGTGGTTCTAGCGTCCTATGCCGTACAATCTCATTTTGGAGAC
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      TGCCCTCTTAACTCAGCAGTGGTTCTAGCGTCCTATGCCGTACAATCTCATTTTGGAGAC
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TATAATTCTTCCATACATCATCCAGGCTATCTTTCCGATAGTCACTTTATACCCGATCAA
NM_002829.3         TATAATTCTTCCATACATCATCCAGGCTATCTTTCCGATAGTCACTTTATACCCGATCAA
NM_001145369.1      TATAATTCTTCCATACATCATCCAGGCTATCTTTCCGATAGTCACTTTATACCCGATCAA
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      TATAATTCTTCCATACATCATCCAGGCTATCTTTCCGATAGTCACTTTATACCCGATCAA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      AATGAGGACTTTTTAACAAAAGTCGAATCTCTGCATGAGCAGCACAGTGGGCTAAAACAA
NM_002829.3         AATGAGGACTTTTTAACAAAAGTCGAATCTCTGCATGAGCAGCACAGTGGGCTAAAACAA
NM_001145369.1      AATGAGGACTTTTTAACAAAAGTCGAATCTCTGCATGAGCAGCACAGTGGGCTAAAACAA
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      AATGAGGACTTTTTAACAAAAGTCGAATCTCTGCATGAGCAGCACAGTGGGCTAAAACAA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TCAGAAGCAGAATCCTGCTATATCAACATAGCGCGGACCCTCGACTTCTATGGAGTAGAA
NM_002829.3         TCAGAAGCAGAATCCTGCTATATCAACATAGCGCGGACCCTCGACTTCTATGGAGTAGAA
NM_001145369.1      TCAGAAGCAGAATCCTGCTATATCAACATAGCGCGGACCCTCGACTTCTATGGAGTAGAA
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      TCAGAAGCAGAATCCTGCTATATCAACATAGCGCGGACCCTCGACTTCTATGGAGTAGAA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      CTGCACAGTGGTAGGGATCTGCACAATTTAGACCTAATGATTGGAATTGCTTCCGCGGGT
NM_002829.3         CTGCACAGTGGTAGGGATCTGCACAATTTAGACCTAATGATTGGAATTGCTTCCGCGGGT
NM_001145369.1      CTGCACAGTGGTAGGGATCTGCACAATTTAGACCTAATGATTGGAATTGCTTCCGCGGGT
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      CTGCACAGTGGTAGGGATCTGCACAATTTAGACCTAATGATTGGAATTGCTTCCGCGGGT
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      GTTGCTGTGTACCGAAAATACATTTGCACAAGTTTCTATCCTTGGGTGAACATTCTCAAA
NM_002829.3         GTTGCTGTGTACCGAAAATACATTTGCACAAGTTTCTATCCTTGGGTGAACATTCTCAAA
NM_001145369.1      GTTGCTGTGTACCGAAAATACATTTGCACAAGTTTCTATCCTTGGGTGAACATTCTCAAA
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      GTTGCTGTGTACCGAAAATACATTTGCACAAGTTTCTATCCTTGGGTGAACATTCTCAAA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      ATTTCTTTCAAAAGGAAAAAGTTCTTCATACATCAGCGACAGAAACAGGCTGAATCCAGG
NM_002829.3         ATTTCTTTCAAAAGGAAAAAGTTCTTCATACATCAGCGACAGAAACAGGCTGAATCCAGG
NM_001145369.1      ATTTCTTTCAAAAGGAAAAAGTTCTTCATACATCAGCGACAGAAACAGGCTGAATCCAGG
NM_001145371.1      ------------------------------------------------------------
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ATTTCTTTCAAAAGGAAAAAGTTCTTCATACATCAGCGACAGAAACAGGCTGAATCCAGG
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      GAACATATTGTGGCCTTCAACATGCTGAATTACCGATCTTGCAAAAACTTGTGGAAATCC
NM_002829.3         GAACATATTGTGGCCTTCAACATGCTGAATTACCGATCTTGCAAAAACTTGTGGAAATCC
NM_001145369.1      GAACATATTGTGGCCTTCAACATGCTGAATTACCGATCTTGCAAAAACTTGTGGAAATCC
NM_001145371.1      ---------------------ATGCTGAATTACCGATCTTGCAAAAACTTGTGGAAATCC
NM_001145372.1      ---------------------ATGCTGAATTACCGATCTTGCAAAAACTTGTGGAAATCC
NM_001145370.1      GAACATATTGTGGCCTTCAACATGCTGAATTACCGATCTTGCAAAAACTTGTGGAAATCC
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TGTGTTGAGCACCATACGTTCTTTCAGGCAAAGAAGCTACTACCTCAGGAAAAGAATGTT
NM_002829.3         TGTGTTGAGCACCATACGTTCTTTCAGGCAAAGAAGCTACTACCTCAGGAAAAGAATGTT
NM_001145369.1      TGTGTTGAGCACCATACGTTCTTTCAGGCAAAGAAGCTACTACCTCAGGAAAAGAATGTT
NM_001145371.1      TGTGTTGAGCACCATACGTTCTTTCAGGCAAAGAAGCTACTACCTCAGGAAAAGAATGTT
NM_001145372.1      TGTGTTGAGCACCATACGTTCTTTCAGGCAAAGAAGCTACTACCTCAGGAAAAGAATGTT
NM_001145370.1      TGTGTTGAGCACCATACGTTCTTTCAGGCAAAGAAGCTACTACCTCAGGAAAAGAATGTT
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      CTGTCTCAGTACTGGACTATGGGCTCTCGGAACACCAAAAAGCG----------------
NM_002829.3         CTGTCTCAGTACTGGACTATGGGCTCTCGGAACACCAAAAAGTCGGTAAATAACCAATAT
NM_001145369.1      CTGTCTCAGTACTGGACTATGGGCTCTCGGAACACCAAAAAGTCGGTAAATAACCAATAT
NM_001145371.1      CTGTCTCAGTACTGGACTATGGGCTCTCGGAACACCAAAAAGTCGGTAAATAACCAATAT
NM_001145372.1      CTGTCTCAGTACTGGACTATGGGCTCTCGGAACACCAAAAAGCG----------------
NM_001145370.1      CTGTCTCAGTACTGGACTATGGGCTCTCGGAACACCAAAAAGCG----------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      ------------------------------------------------------------
NM_002829.3         TGCAAAAAGGTGATTGGCGGGATGGTGTGGAACCCAGCCATGCGGAGATCCTTATCAGTG
NM_001145369.1      TGCAAAAAGGTGATTGGCGGGATGGTGTGGAACCCAGCCATGCGGAGATCCTTATCAGTG
NM_001145371.1      TGCAAAAAGGTGATTGGCGGGATGGTGTGGAACCCAGCCATGCGGAGATCCTTATCAGTG
NM_001145372.1      ------------------------------------------------------------
NM_001145370.1      ------------------------------------------------------------
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      -----------------------------------------------------------A
NM_002829.3         GAGCACTTAGAAACCAAGAGTCTGCCTTCTCGTTCCCCTCCCATTACTCCCAACTGGCGA
NM_001145369.1      GAGCACTTAGAAACCAAGAGTCTGCCTTCTCGTTCCCCTCCCATTACTCCCAACTGGCGA
NM_001145371.1      GAGCACTTAGAAACCAAGAGTCTGCCTTCTCGTTCCCCTCCCATTACTCCCAACTGGCGA
NM_001145372.1      -----------------------------------------------------------A
NM_001145370.1      -----------------------------------------------------------A
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      AGTCCTCGGCTCCGGCACGAAATCCGAAAGCCACGCCACTCTTCTGCAGATAACCTTGCA
NM_002829.3         AGTCCTCGGCTCCGGCACGAAATCCGAAAGCCACGCCACTCTTCTGCAGATAACCTTGCA
NM_001145369.1      AGTCCTCGGCTCCGGCACGAAATCCGAAAGCCACGCCACTCTTCTGCAGATAACCTTGCA
NM_001145371.1      AGTCCTCGGCTCCGGCACGAAATCCGAAAGCCACGCCACTCTTCTGCAGATAACCTTGCA
NM_001145372.1      AGTCCTCGGCTCCGGCACGAAATCCGAAAGCCACGCCACTCTTCTGCAGATAACCTTGCA
NM_001145370.1      AGTCCTCGGCTCCGGCACGAAATCCGAAAGCCACGCCACTCTTCTGCAGATAACCTTGCA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      AATGAAATGACCTACATCACGGAAACGGAAGATGTATTTTACACGTACAAGGGCTCTCTG
NM_002829.3         AATGAAATGACCTACATCACGGAAACGGAAGATGTATTTTACACGTACAAGGGCTCTCTG
NM_001145369.1      AATGAAATGACCTACATCACGGAAACGGAAGATGTATTTTACACGTACAAGGGCTCTCTG
NM_001145371.1      AATGAAATGACCTACATCACGGAAACGGAAGATGTATTTTACACGTACAAGGGCTCTCTG
NM_001145372.1      AATGAAATGACCTACATCACGGAAACGGAAGATGTATTTTACACGTACAAGGGCTCTCTG
NM_001145370.1      AATGAAATGACCTACATCACGGAAACGGAAGATGTATTTTACACGTACAAGGGCTCTCTG
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      GCCCCTCAAGACAGCGATTCTGAAGTTTCTCAGAACCGAAGCCCGCACCAAGAGAGTTTA
NM_002829.3         GCCCCTCAAGACAGCGATTCTGAAGTTTCTCAGAACCGAAGCCCGCACCAAGAGAGTTTA
NM_001145369.1      GCCCCTCAAGACAGCGATTCTGAAGTTTCTCAGAACCGAAGCCCGCACCAAGAGAGTTTA
NM_001145371.1      GCCCCTCAAGACAGCGATTCTGAAGTTTCTCAGAACCGAAGCCCGCACCAAGAGAGTTTA
NM_001145372.1      GCCCCTCAAGACAGCGATTCTGAAGTTTCTCAGAACCGAAGCCCGCACCAAGAGAGTTTA
NM_001145370.1      GCCCCTCAAGACAGCGATTCTGAAGTTTCTCAGAACCGAAGCCCGCACCAAGAGAGTTTA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TCCGAGAACAATCCGGCACAAAGCTACCTGACCCAGAAGTCATCCAGTTCTGTGTCTCCA
NM_002829.3         TCCGAGAACAATCCGGCACAAAGCTACCTGACCCAGAAGTCATCCAGTTCTGTGTCTCCA
NM_001145369.1      TCCGAGAACAATCCGGCACAAAGCTACCTGACCCAGAAGTCATCCAGTTCTGTGTCTCCA
NM_001145371.1      TCCGAGAACAATCCGGCACAAAGCTACCTGACCCAGAAGTCATCCAGTTCTGTGTCTCCA
NM_001145372.1      TCCGAGAACAATCCGGCACAAAGCTACCTGACCCAGAAGTCATCCAGTTCTGTGTCTCCA
NM_001145370.1      TCCGAGAACAATCCGGCACAAAGCTACCTGACCCAGAAGTCATCCAGTTCTGTGTCTCCA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TCTTCAAATGCTCCAGGCTCCTGCTCACCTGACGGCGTTGATCAGCAGCTCTTAGATGAC
NM_002829.3         TCTTCAAATGCTCCAGGCTCCTGCTCACCTGACGGCGTTGATCAGCAGCTCTTAGATGAC
NM_001145369.1      TCTTCAAATGCTCCAGGCTCCTGCTCACCTGACGGCGTTGATCAGCAGCTCTTAGATGAC
NM_001145371.1      TCTTCAAATGCTCCAGGCTCCTGCTCACCTGACGGCGTTGATCAGCAGCTCTTAGATGAC
NM_001145372.1      TCTTCAAATGCTCCAGGCTCCTGCTCACCTGACGGCGTTGATCAGCAGCTCTTAGATGAC
NM_001145370.1      TCTTCAAATGCTCCAGGCTCCTGCTCACCTGACGGCGTTGATCAGCAGCTCTTAGATGAC
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TTCCACAGGGTGACCAAAGGGGGCTCCACCGAGGACGCCAGCCAGTACTACTGTGACAAG
NM_002829.3         TTCCACAGGGTGACCAAAGGGGGCTCCACCGAGGACGCCAGCCAGTACTACTGTGACAAG
NM_001145369.1      TTCCACAGGGTGACCAAAGGGGGCTCCACCGAGGACGCCAGCCAGTACTACTGTGACAAG
NM_001145371.1      TTCCACAGGGTGACCAAAGGGGGCTCCACCGAGGACGCCAGCCAGTACTACTGTGACAAG
NM_001145372.1      TTCCACAGGGTGACCAAAGGGGGCTCCACCGAGGACGCCAGCCAGTACTACTGTGACAAG
NM_001145370.1      TTCCACAGGGTGACCAAAGGGGGCTCCACCGAGGACGCCAGCCAGTACTACTGTGACAAG
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      AATGATAATGGTGACAGCTACTTAGTCTTGATCCGTATCACACCAGATGAAGATGGAAAA
NM_002829.3         AATGATAATGGTGACAGCTACTTAGTCTTGATCCGTATCACACCAGATGAAGATGGAAAA
NM_001145369.1      AATGATAATGGTGACAGCTACTTAGTCTTGATCCGTATCACACCAGATGAAGATGGAAAA
NM_001145371.1      AATGATAATGGTGACAGCTACTTAGTCTTGATCCGTATCACACCAGATGAAGATGGAAAA
NM_001145372.1      AATGATAATGGTGACAGCTACTTAGTCTTGATCCGTATCACACCAGATGAAGATGGAAAA
NM_001145370.1      AATGATAATGGTGACAGCTACTTAGTCTTGATCCGTATCACACCAGATGAAGATGGAAAA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TTTGGATTTAATCTTAAGGGAGGAGTGGATCAAAAGATGCCTCTTGTGGTATCAAGGATA
NM_002829.3         TTTGGATTTAATCTTAAGGGAGGAGTGGATCAAAAGATGCCTCTTGTGGTATCAAGGATA
NM_001145369.1      TTTGGATTTAATCTTAAGGGAGGAGTGGATCAAAAGATGCCTCTTGTGGTATCAAGGATA
NM_001145371.1      TTTGGATTTAATCTTAAGGGAGGAGTGGATCAAAAGATGCCTCTTGTGGTATCAAGGATA
NM_001145372.1      TTTGGATTTAATCTTAAGGGAGGAGTGGATCAAAAGATGCCTCTTGTGGTATCAAGGATA
NM_001145370.1      TTTGGATTTAATCTTAAGGGAGGAGTGGATCAAAAGATGCCTCTTGTGGTATCAAGGATA
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      AACCCAGAGTCACCTGCGGACACCTGCATTCCTAAGCTGAACGAAGGGGATCAAATCGTG
NM_002829.3         AACCCAGAGTCACCTGCGGACACCTGCATTCCTAAGCTGAACGAAGGGGATCAAATCGTG
NM_001145369.1      AACCCAGAGTCACCTGCGGACACCTGCATTCCTAAGCTGAACGAAGGGGATCAAATCGTG
NM_001145371.1      AACCCAGAGTCACCTGCGGACACCTGCATTCCTAAGCTGAACGAAGGGGATCAAATCGTG
NM_001145372.1      AACCCAGAGTCACCTGCGGACACCTGCATTCCTAAGCTGAACGAAGGGGATCAAATCGTG
NM_001145370.1      AACCCAGAGTCACCTGCGGACACCTGCATTCCTAAGCTGAACGAAGGGGATCAAATCGTG
                                                                                

HsCD00285675        ------------------------------------------------------------
NM_001145368.1      TTAATCAATGGCCGGGACATCTCAGAACACACGCATGACCAAGTGGTGATGTTCATCAAA
NM_002829.3         TTAATCAATGGCCGGGACATCTCAGAACACACGCATGACCAAGTGGTGATGTTCATCAAA
NM_001145369.1      TTAATCAATGGCCGGGACATCTCAGAACACACGCATGACCAAGTGGTGATGTTCATCAAA
NM_001145371.1      TTAATCAATGGCCGGGACATCTCAGAACACACGCATGACCAAGTGGTGATGTTCATCAAA
NM_001145372.1      TTAATCAATGGCCGGGACATCTCAGAACACACGCATGACCAAGTGGTGATGTTCATCAAA
NM_001145370.1      TTAATCAATGGCCGGGACATCTCAGAACACACGCATGACCAAGTGGTGATGTTCATCAAA
                                                                                

HsCD00285675        -----------------------------------------------ATTCGCCCTTCGC
NM_001145368.1      GCCAGCCGGGAGTCCCACTCACGGGAGCTGGCCCTGGTGATCAGGAGGAGAGCTGTCCGC
NM_002829.3         GCCAGCCGGGAGTCCCACTCACGGGAGCTGGCCCTGGTGATCAGGAGGAGAGCTGTCCGC
NM_001145369.1      GCCAGCCGGGAGTCCCACTCACGGGAGCTGGCCCTGGTGATCAGGAGGAGAGCTGTCCGC
NM_001145371.1      GCCAGCCGGGAGTCCCACTCACGGGAGCTGGCCCTGGTGATCAGGAGGAGAGCTGTCCGC
NM_001145372.1      GCCAGCCGGGAGTCCCACTCACGGGAGCTGGCCCTGGTGATCAGGAGGAGAGCTGTCCGC
NM_001145370.1      GCCAGCCGGGAGTCCCACTCACGGGAGCTGGCCCTGGTGATCAGGAGGAGAGCTGTCCGC
                                                                   .: .**  * ***

HsCD00285675        TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
NM_001145368.1      TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
NM_002829.3         TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
NM_001145369.1      TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
NM_001145371.1      TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
NM_001145372.1      TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
NM_001145370.1      TCATTTGCTGACTTCAAGTCTGAAGATGAACTGAACCAGCTTTTCCCCGAAGCCATTTTC
                    ************************************************************

HsCD00285675        CCCATGTATCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
NM_001145368.1      CCCATGTGTCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
NM_002829.3         CCCATGTGTCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
NM_001145369.1      CCCATGTGTCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
NM_001145371.1      CCCATGTGTCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
NM_001145372.1      CCCATGTGTCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
NM_001145370.1      CCCATGTGTCCGGAGGGTGGGGACACTTTGGAGGGATCCATGGCACAGCTAAAGAAGGGC
                    *******.****************************************************

HsCD00285675        CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
NM_001145368.1      CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
NM_002829.3         CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
NM_001145369.1      CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
NM_001145371.1      CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
NM_001145372.1      CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
NM_001145370.1      CTCGAAAGCGGGACGGTGCTGATCCAGTTTGAGCAACTCTACAGAAAAAAGCCAGGTTTG
                    ************************************************************

HsCD00285675        GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
NM_001145368.1      GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
NM_002829.3         GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
NM_001145369.1      GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
NM_001145371.1      GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
NM_001145372.1      GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
NM_001145370.1      GCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTG
                    ************************************************************

HsCD00285675        CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
NM_001145368.1      CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
NM_002829.3         CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
NM_001145369.1      CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
NM_001145371.1      CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
NM_001145372.1      CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
NM_001145370.1      CCTTATGACACCACCCGGGTATTATTGCAGGGAAATGAAGATTATATTAATGCAAGTTAC
                    ************************************************************

HsCD00285675        GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
NM_001145368.1      GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
NM_002829.3         GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
NM_001145369.1      GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
NM_001145371.1      GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
NM_001145372.1      GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
NM_001145370.1      GTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCC
                    ************************************************************

HsCD00285675        CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
NM_001145368.1      CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
NM_002829.3         CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
NM_001145369.1      CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
NM_001145371.1      CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
NM_001145372.1      CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
NM_001145370.1      CTGCCGCATACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATT
                    ************************************************************

HsCD00285675        GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
NM_001145368.1      GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
NM_002829.3         GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
NM_001145369.1      GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
NM_001145371.1      GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
NM_001145372.1      GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
NM_001145370.1      GTCATGTTGACGACTCTCACAGAACGAGGGCGGACCAAATGTCACCAGTACTGGCCAGAT
                    ************************************************************

HsCD00285675        CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
NM_001145368.1      CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
NM_002829.3         CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
NM_001145369.1      CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
NM_001145371.1      CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
NM_001145372.1      CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
NM_001145370.1      CCCCCCGACGTCATGAACCACGGCGGCTTTCACATCCAGTGTCAGTCAGAGGACTGCACC
                    ************************************************************

HsCD00285675        ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
NM_001145368.1      ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
NM_002829.3         ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
NM_001145369.1      ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
NM_001145371.1      ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
NM_001145372.1      ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
NM_001145370.1      ATCGCCTATGTGTCCCGAGAAATGCTGGTCACAAACACCCAGACCGGGGAAGAACACACA
                    ************************************************************

HsCD00285675        GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
NM_001145368.1      GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
NM_002829.3         GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
NM_001145369.1      GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
NM_001145371.1      GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
NM_001145372.1      GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
NM_001145370.1      GTGACACATCTCCAGTACGTCGCATGGCCTGACCACGGTGTGCCCGATGACTCCTCCGAC
                    ************************************************************

HsCD00285675        TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
NM_001145368.1      TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
NM_002829.3         TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
NM_001145369.1      TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
NM_001145371.1      TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
NM_001145372.1      TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
NM_001145370.1      TTTCTGGAATTTGTAAACTATGTGAGGTCTCTGAGAGTGGACAGCGAGCCCGTCCTAGTT
                    ************************************************************

HsCD00285675        CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
NM_001145368.1      CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
NM_002829.3         CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
NM_001145369.1      CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
NM_001145371.1      CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
NM_001145372.1      CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
NM_001145370.1      CACTGCAGTGCTGGAATAGGTCGAACCGGTGTGTTGGTCACTATGGAAACAGCCATGTGC
                    ************************************************************

HsCD00285675        CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
NM_001145368.1      CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
NM_002829.3         CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
NM_001145369.1      CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
NM_001145371.1      CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
NM_001145372.1      CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
NM_001145370.1      CTAACTGAGAGGAACCTGCCCATTTACCCACTGGATATTGTCCGAAAAATGCGAGACCAG
                    ************************************************************

HsCD00285675        CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
NM_001145368.1      CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
NM_002829.3         CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
NM_001145369.1      CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
NM_001145371.1      CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
NM_001145372.1      CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
NM_001145370.1      CGCGCCATGATGGTGCAGACATCAAGCCAGTACAAGTTTGTGTGTGAAGCGATTCTTCGT
                    ************************************************************

HsCD00285675        GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTAAGGGGCGAATTCGT
NM_001145368.1      GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTTAA------------
NM_002829.3         GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTTAA------------
NM_001145369.1      GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTTAA------------
NM_001145371.1      GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTTAA------------
NM_001145372.1      GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTTAA------------
NM_001145370.1      GTGTATGAAGAAGGTTTAGTCCAAATGCTGGATCCTAGTTAA------------
                    ***************************************:*.            

Protein

SMART domain : PTPc_motif : Protein tyrosine phosphatase, catalytic domain motif
SMART domain : PTPc : Protein tyrosine phosphatase, catalytic domain
Structural Annotation Wiki : TOPSAN
UniProt : B7Z9V1
UniProt : E9PGU7
UniProt : B7ZA03
UniProt : E7EN99
UniProt : P26045
UniProt : Q8N4S3
UniProt : B7Z3V3
HPRD : 06767

Clone

Cloning Information : 451519
HIP Master Clone ID : 381005
Original Clone ID : 8603a1ZBt2

Experimental

TargetTrack - Experimental data : NYSGXRC-8603a

Organism


TAX_ID : 9606
Species Specific ID: None

Genome

Chromosome : 9
Map Location : 9q31
Ensembl : ENSG00000070159